Screening and Verification of Host Proteins Interacting with Neospora Caninum&nbsp;AMA1&nbsp;Using a Yeast Two-hybrid System

doi:10.21203/rs.3.rs-96285/v1

Download PDF

Research

Screening and Verification of Host Proteins Interacting with Neospora Caninum AMA1 Using a Yeast Two-hybrid System

https://doi.org/10.21203/rs.3.rs-96285/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Neospora caninum apical membrane antigen 1 (NcAMA1) is a conservative type I transmembrane protein that is secreted by the microneme to the surface of the parasite, and is a key component of the invasion mechanism. In order to explore further the biological functions of NcAMA1 in the process of parasite invasion, we conducted research on NcAMA1 and its interacting partners.

Methods: In this study, Vero cell yeast two-hybrid (Y2H) cDNA library was constructed. Using the constructed recombinant vector pGBKT7-NcAMA1 as bait, the Y2H system was used to screen the proteins that interact with NcAMA1. In addition, the interaction between NcAMA1 and the screened transmembrane emp24 domain trafficking protein 2 （Tmed2）was further verified by one-to-one Y2H experiments and pull-down, and the role of Tmed2 protein in the process of N. caninum invasion was initially verified by RNA silencing and antibody blocking experiments.

Results: Our results show that, through the Y2H experiment, we have identified two proteins that interact with NcAMA1, which are the Chlorocebus sabaeus filamin A, alpha and Chlorocebus sabaeus Tmed2. When the expression of Tmed2 protein decreased or blocked, the invasion rate of N. caninum was increased.

Conclusions: These findings give us a deeper understanding of the biological functions of NcAMA1, and for the first time suggest that Tmed2 may be involved in the process invasion by of N. caninum, inhibiting the invasion of parasites by interacting with the protein secreted by N. caninum.

Parasitology

Neospora caninum

NcAMA1

screening

yeast two-hybrid

Neosporosis is a disease of the placenta and fetus caused by maternal parasites. It is caused by maternal infections and can also be caused by persistent infections during pregnancy ^{[1, 2]}. As an obligate intracellular parasite, Neospora caninum, like other Apicomplexan protozoa, is unable to survive for extended periods outside the cell ^[3]. Therefore, the invasion of new cells is very important for the survival and proliferation of N. caninum. The invasion of the host cell by N. caninum is accompanied by the formation of a parasitophorous vacuole (PV). The parasites in the PV rapidly increase in number via a binary division. When the parasite invades host cells, it has specialized secretory organelles, including the microneme (MIC), rhoptry (ROP), and dense granules (GRA) ^[4]. These organelles coordinate with each other to ensure the survival and development of the parasite. These structural features also allow the parasite to invade host cells by following a relatively conservative pattern ^[5].

In previous research, significant progress has been made in understanding the factors involved in the pathogenesis of N. caninum. These advances include the identification of several parasite-derived effector proteins, such as the identification of ROP proteins and MIC proteins, respectively ^{[6, 7]}. These effectors are essential for invasion and colonization by N. caninum ^[8–10]. Among them, apical membrane antigen1 (AMA1) is a conservative type I transmembrane protein that is secreted from the MIC to the surface of the parasite and is a key component of the invasion mechanism ^[11].

AMA1 may be the most studied protein in the apical complex, and it is also a long-standing vaccine candidate ^{[12, 13]}. AMA1 enhances the systemic invasion of tachyzoites, which attach to host cells in parallel; the Plasmodium, which lacked AMA1, cannot be closely integrated with host cells, and are severely damaged during the invasion process ^[14]. Like other MIC proteins, AMA1 is proteolyzed to the surface of the parasite after secretion, thereby releasing it to the exterior ^[15]. Other studies have shown that the NcAMA1 nucleic acid vaccine can invoke a certain degree of immune protection against neosporosis ^[16].

Since Fields and Song introduced the yeast two-hybrid (Y2H) system in 1989 ^[17], this method of studying protein–protein interactions has become one of the most popular techniques. The classic Y2H system is relatively easy to establish and is particularly helpful for studying human proteins. The relationship between N. caninum and the host is complex, and a variety of protein molecules are involved in regulation. Therefore, in this experiment, NcAMA1 was used to screen proteins interacting with a Vero cell cDNA library using the Y2H technique, which provided a new candidate molecule for the study of invasive proteins.

Bait plasmid construction

According to the gene sequence of NcAMA1 (AB265823.1) in GenBank, primers NcAMA1-N/PF: 5'-CATGCCATGGATTAACCCGAAGACTA-3' and NcAMA1-N/PR: 5'-TGCACTGCAGTGCCGTATTAGAGCCG-3' were designed. The cycling conditions consisted of denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 1 min, 58°C for 1 min, 72°C for 1 min 30 s, and a final extension at 72°C for 5 min. The size of the amplicon was about 1500 base pairs (bp). The PCR product was attached to pMD19T (Simple) (TaKaRa, Dalian, China), and then the NcAMA1 gene was inserted into the pGBKT7 vector using Nco I and Pst I (Promega, Beijing, China) to obtain the decoy vector pGBKT7-NcAMA1.

Expression of bait in yeast cells

The pGBKT7-NcAMA1 decoy vector was transformed into the Y2H Gold yeast strain using the Yeastmaker^TM Yeast Transformation System 2 kit (Clontech, Dalian, China) and cultured in plates containing the minimal yeast medium without tryptophan deficient solid medium (SD/-Trp ) (TaKaRa) for 4 days in a 30°C incubator. A single clone was picked and inoculated into 10 mL of SD/-Trp liquid medium and cultured overnight at 30°C with shaking. The clones were then transferred to 50 mL YPDA liquid medium (Solarbio, Beijing, China) and incubated at 30 °C until the OD₆₀₀ reached 0.4–0.5. The protein was extracted using the Yeast Total Protein Extraction Kit (Sangon Biotech, Shanghai, China). For the Western blotting, the anti-c-Myc monoclonal antibody (SIGMA, St. Louis, USA) as a primary antibody, and the goat anti mouse IgG1 as a secondary antibody, finally the results were visualized by staining with 3,3'-diaminobenzidine (DAB) (ZSGB-BIO, Beijing, China).

Autoactivation and toxicity test

The transformed product was screened on SD/-Trp, SD/-Trp supplemented with 40 ug/ml X-α-Gal（SD/-Trp/X-α-gal), SD/-Trp supplemented with 40 ug/ml X-α-Gal and 125 ng/ml Aureobasidin (SD/-Trp/X-α-gal/Aba) deficient solid medium, and cultured for 4 days before growth was observed. The transformed product was screened on SD/-Trp deficient solid medium and cultured for 4 days at 30 °C, and a single colony was picked and inoculated into 50 mL of SD/-Trp Kan⁺ liquid medium. The colony was incubated for 24 h, and the OD₆₀₀value of the bacterial solution was measured. If the OD₆₀₀ exceeded 0.8, the recombinant plasmid pGBKT7-NcAMA1 was not toxic to yeast cells.

Screening of Vero cDNA library by Y2H

Single colonies cultured in SD/-Trp deficient medium for 4 days were picked and cultured in 50 mL SD/-Trp liquid medium at 30°C until the OD₆₀₀ was greater than 0.8. The culture was fused with the cDNA library at 30°C with slow shaking to induce the presence of heterozygotes. The mated culture was screened on SD/-Trp, SD/-Leu, and SD/-Leu/-Trp solid medium, and cultured for 5 days at 30 °C. The hybridization efficiency and the total number of clones were calculated; 200 μL of the hybridization product was uniformly coated on a 150 mm SD/-Ade/-His/-Leu/-Trp (QDO) highly deficient solid medium, and cultured for 5 days at 30°C. Single colonies growing on the medium were again transferred to SD/–Ade/–His/–Leu/–Trp supplemented with X-a-Gal and Aureobasidin A (QDO/X/A) highly deficient solid medium and inverted culture was performed at 30°C.

Identification and sequencing of positive clones

Positive clones were obtained by PCR amplification using a library of universal primers, and PCR positive bacterial plasmids were extracted according to the instructions for the TIANprep Yeast Plasmid Isolation Kit (TIANGEN, Beijing, China). The plasmid was transformed into E. coli competent DH5α, and the colony was identified by PCR and sequenced. The sequencing results were compared using BLAST on NCBI to obtain the gene interacting with pGBKT7-NcAMA1.

Pull down experiment

The Tmed2 and NcAMA1 genes were obtained using the primers Tmed2-B/NF 5'-GGATCCATGGTGACGCTTGCTGAA-3', Tmed2-B/NR 5'-GCGGCCGCTTAAACAACCCTCCGG-3' (XM_008005126.1), NcAMA1-BNF 5'-CGGGATCCATTAACCCGAAGACTA-3', NcAMA1-BNR 5'-TTGCGGCCGCTGCCGTATTAGAGCCG-3' (AB26582 3.1), and subsequently the Tmed2 gene was cloned into the pGEX-4T1 vector, and the NcAMA1 gene was cloned into the pET28a vector, to obtain Tmed2 protein and NcAMA1 protein. Glutathione Sepharose 4B (Amersham Biosciences, Louis, USA) was washed thoroughly using PBS and mixed with the Tmed2 protein. After incubation overnight at 4°C, the GST agarose beads were washed using PBS, mixed with the NcAMA1 protein, and incubated overnight at 4°C. Finally, the NcAMA1 protein supernatant was recovered, the GST agarose beads were washed and resuspended with PBS, and were then analyzed by Western blotting.

Silence interference experiment

For the Tmed2 silencing in Vero cells, three siRNA silencing interference sequences were designed, namely siRNA1 (passenger sequence 5'-AGCUAGAAGAAAUGAUCAAUG-3', guide sequence 5'-UUGAUCAUUUUCUUCUAGCUUG-3'), siRNA2 (passenger sequence 5'-GGACCAGAUAACAAAGGAAU, guide sequence 5'-UUCCUUUGUUAUCUGGUGUCCUG-3'), and siRNA3 (passenger sequence 5'-CCUUCUAAUUGUCUGUUAAAG-3', guide sequence 5'-UUAACAGACAAUUAGAAGGUU-3'). Vero cells were cultured in a 6-well plate and the cell number adjusted to 1×10⁵ in each well. After the cell was full in the well, the siRNA silencing sequence was transfected into Vero cells using Lipofectamine® 2000 (Invitrogen, Shanghai, China). The cells were cultured for 24 h, and the cell mRNA and protein lysate were extracted to test the Tmed2 gene silencing efficacy in order to screen for the best silencing sequence. The β-actin primers (F: 5'-CTGGACTTCGAGCAGGAGATG-3'; R: 5'-CGGATGTCCACGTCACACTTC-3'), used as internal reference control primers, and Tmed2-RT-F (5'-ACATTTGCTGCTCACATGGAC-3') and Tmed2-RT-R (5'-GCCTCCCCAATATCAATGGTG-3'), used as test primers, were used to measure the effect of interference on the mRNA level by real-time PCR. Anti-Tmed2 polyclonal antibody was used as the primary antibody and goat anti-rabbit IgG as the secondary antibody to detect the interference effect at the protein level by a Western blotting experiment. The best silence sequence was transfected into Vero cells and cultured for 48 h; cells were collected every 12 h and used to determine the best interference time by real-time PCR.

Intrusion experiment

Vero cells were divided into three groups, namely the antibody blocking group, the RNA silencing group and the blank control group. After performing RNA silence interference and antibody blocking experiments, the N. caninum parasites were added to Vero cells and allowed to invade under normal growth conditions for 3 h. The extracellular parasites were labeled with mouse polyclonal antibodies and visualized with non-permeabilized Alexa Fluor 594-conjugated rabbit anti-mouse IgG. At room temperature, 0.3% Triton X-100 prepared with PBS was used to infiltrate the parasite-infected cells for 15 min. The intercellular and extracellular parasites were labeled with mouse polyclonal antibodies and visualized with Alexa Fluor 488 conjugated rabbit anti-mouse IgG. According to the infiltration rate = [(green fluorescence number – red fluorescence number)/green fluorescence number × 100%] the infiltration rate of each group was calculated. The results were obtained from three independent biological replicates.

Construction of the bait plasmid

The coding sequence of NcAMA1 (1500 bp) was successfully amplified from the NC-1 strain cDNA (Fig. 1A) and cloned into the pGBKT7 vector between the Nco I and Pst I sites. The recombinant plasmid pGBKT7-NcAMA1 was identified by digestion, as shown in Fig. 1B. Sequencing result showed that the homology was 100% with the NcAMA1 gene (AB26582 3.1).

Bait protein expression

Before the Y2H screening, the protein expressed by the pGBKT7-NcAMA1 bait vector was identified in vitro using Western blotting. The size of the NcAMA1 protein was about 68 Ku, which was consistent with the expected size (Fig. 2).

Autoactivation and toxicity test

In order to test the autoactivation activity of the bait protein in yeast cells, the pGBKT7-NcAMA1 yeast transformation product was screened on SD/-Trp, SD/-Trp/X-α-gal and SD/-Trp/X-α-gal/Aba defective solid medium, respectively. As shown in Fig. 3, after 4 days of culture at 30°C, there was growth of white yeast cones on the SD/-Trp and SD/-Trp/X-α-gal defective solid medium, while no clone growth was observed on SD/-Trp/X-α-gal/Aba defective solid medium. This indicates that the protein expressed by the bait vector pGBKT7-NcAMA1 has no autoactivation and can be applied to the Y2H system.

A single colony on SD/-Trp-deficient solid medium was picked and inoculated in 50 mL SD/-Trp Kan⁺ liquid medium. Following incubation for 20–24 h at 30°C with shaking, the OD₆₀₀ of the test solution exceeded 0.8 (data not shown), indicating that the recombinant plasmid pGBKT7-NcAMA1 was not toxic to yeast cells.

Yeast-two-hybrid screening of the Vero cell cDNA library

After the Vero cell cDNA library host strain was mixed with the bait plasmid pGBKT7-NcAMA1 transformed yeast, a diploid clover structure or a “Mickey head” shape was observed under an inverted microscope (data not shown). The hybridization efficiency of this screening was calculated to be 38.92%, and a total of 3.172 × 10⁸ clones were screened (data not shown).

The putatively positive clones were identified by PCR with primers 3' AD (GTGAACTTGCGGGGTTTTTCAGTATCTACGAT) and 5' AD (CTATTCGATGATGAAGATACCCCACCAAACCC) as shown in Fig. 4.

Sequencing and analysis of positive prey

In order to investigate the host protein that interacts with the NcAMA1 protein, the positive prey clones were sequenced. The sequencing results were analyzed by the BLAST tool in NCBI. The results showed that screened inserted genes were highly similar to two known protein genes (99% to 100%), Chlorocebus sabaeus filamin A, alpha (FLNA) (XM_007993135.1) and Chlorocebus sabaeus Tmed2 (XM_008005126.1).

The correctly sequenced positive plasmid and bait vector were used to transform competent cells of the Y2H strain. A control group was set up at the same time, transferring the pGBKT7 empty vector and positive plasmid together. The transformed bacterial solution was grown onto SD/-QDO/X/A defective solid medium, cultured for 4 days at 30 °C, and the growth status observed. The yeast strain introduced with the bait vector and the positive plasmid grew blue clones on the highly defective medium, and the control group grew aseptic colonies (Fig. 5); the plasmid could be judged as a positive result, and subsequent tests were able to be performed.

Pull down experiment

The final GST agarose beads were subjected to western blotting experiments. A GST monoclonal antibody was used as the primary antibody, and goat anti-mouse IgG1 as the secondary antibody. The results showed a bound protein band with a size of about 118 Ku, which demonstrated that NcAMA1 protein could interact with the Tmed2 protein in vitro (Fig. 6).

RNA silencing interference

After synthesizing three siRNA fragments targeting Tmed2, they were transfected into Vero cells with Lipofectamine® 2000. The mRNA and protein lysates of the Vero cells were extracted, respectively, and the best silencing sequence was determined by real-time-PCR and western blot experiments (Fig. 7). The results showed that after Vero cells were transfected with the siRNA3 infection sequence, the protein expression and mRNA expression of Tmed2 protein decreased significantly. Therefore, siRNA3 was used as the silencing interference sequence for the experiment.

In order to determine the best time for silencing, 1 × 10⁵ Vero cells/well were seeded into a six-well plate. After the cells were full, they were transfected with a silencing plasmid. At the end of the experiment, the mRNA level of Tmed2 at each time point was detected by fluorescent quantitative PCR, and the results showed that 24 h was the best time-point for silencing (Fig. 8).

Intrusion experiment

According to the invasion rate = [(green fluorescence number – red fluorescence number)/green fluorescence number] ×100%, the invasion rate of each group was calculated. In the final control group, at 1, 2, and 3 h, the insect invasion rate was 31.47%, 34.77%, and 38.32%, respectively. The insect invasion rates of the antibody blocking group were 40.60%, 41.62%, and 63.55%, respectively, and those of the RNA silencing group were 32.22%, 36.47%, and 49.00%, respectively. At 1 and 2 h after invasion, the invasion rate of the antibody blocking group was significantly higher than that of the blank control group (p < 0.05), and there was no significant difference between the RNA silencing group and the blank control group (P > 0.05). In the 3 h antibody blocking group, the invasion rate was significantly higher than that of the blank control group (P < 0.01), and the intrusion rate of the RNA silencing group was significantly higher than that of the blank control group (P < 0.05; Fig. 9). After antibody blocking and gene silencing of Tmed2 protein in Vero cells, which down-regulated the expression of Tmed2 protein, the invasion rate of parasites increased, and it can be preliminarily judged that the Tmed2 protein in Vero cells played a role in recognition of parasites during the invasion, combined with its role of inhibiting entry of parasites into the cell.

There have been a large number of studies on the NcAMA1 protein ^[18]. Studies have shown that the neck protein RON2, secreted by the rod-shaped body of N. caninum, and the NcAMA1 protein secreted by the microneme are involved in the invasion process of the NcAMA1 through interaction ^{[19, 20]}. Researchers have discovered that the C-terminal of RON2 is the region that binds to AMA1 with high affinity ^[21–23]. The RON2 protein is combined with rod-shaped neck proteins (RON4, RON5 and RON8) secreted by other rod-shaped bodies and secreted into host cells ^[24]. This hetero-oligomeric RON protein complex will bind to host cells and transform during the process of internalization of the parasite. During the invasion process, moving junction (MJ) moves from the front to the back of the parasite, dragging the parasite into the parasitophorous vacoule (PV), conferring slenderness that allows the N. caninum to enter the cell interior ^[25]. Some studies have used anti-NcAMA1 antibody to incubate the N. caninum tachyzoites, which can inhibit the invasion of host cells by N. caninum ^[26]. However, there are few studies on the interaction between NcAMA1 protein and host cells during invasion. In this study, the NcAMA1 protein was used as the research object, and the host protein that interacts with the NcAMA1 protein in the host cell was screened to provide a molecular basis for the invasion process of N. caninum.

This experiment successfully amplified the NcAMA1 fragment from N. caninum and ligated it with the Y2H expression vector pGBKT7 to construct the Y2H bait vector pGBKT7-NcAMA1 of the NcAMA1 protein. The recombinant bait vector plasmid was transformed into yeast cells. Through Y2H screening of the proteins that interact with NcAMA1 protein in host cells, our results show two host cell proteins, FLNA and Tmed2, that interact with NcAMA1 protein.

The Tmed protein family is a class of proteins involved in vesicle transport in the cytoplasm. In vertebrates, the Tmed family contains ten members, which can be classified into four subfamilies based on sequence homology: three belong to the α subfamily (Tmed4, 9, and 11); one belongs to the β subfamily (Tmed2); five to the γ subfamily (Tmed1, 3, 5, 6, and 7); and one is in the δ subfamily (Tmed10) ^[27]. Among them, Tmed2 is the only member of the vertebrate Tmedβ subfamily. It exhibits tissue- and time-specific expression patterns in embryos and the developing placenta ^{[28, 29]}, but is commonly expressed in all adult organs ^[30]. Tmed2 is a type I transmembrane protein, which is considered to be a protein receptor, and is mainly involved in the transport of the endoplasmic reticulum and the Golgi apparatus of coat protein complex I (COPI), mediated by vesicles ^[31]. Studies have shown that the Tmed2 protein can enhance cell function by enhancing the dimerization of mediator of interferon regulating factor 3 activation (MITA), providing an immune response to DNA viruses ^[32].

Reports indicate that the NcAMA1 protein is mainly involved in the process of contact with the host surface during the invasion of N. caninum ^[33]. We speculated that Tmed2, as a membrane protein, may interact with the NcAMA1 protein to inhibit the invasion of N. caninum or serve as a target protein promoting the invasion of N. caninum. For preliminary verification, this experiment conducted interference silencing and antibody blocking experiments against the host cell Tmed2 protein. It was found that, after the Tmed2 protein expression decreased or was blocked, the N. caninum invasion rate increased, indicating that the Tmed2 protein and the NcAMA1 protein interact with each other to inhibit the invasion of host cells by N. caninum, thereby protecting the host cells.

Given that our research is limited to the identification of proteins in Y2H, further work is needed to evaluate the importance of the possible role of the interaction between host cells and N. caninum proteins in the process of invasion by N. caninum. However, the two host cell proteins screened in this experiment and the preliminary verification of the inhibitory effect of Tmed2 protein on the invasion of N. caninum provide some new clues for studying the biological functions of NcAMA1.

In this study, two host proteins, FLNA and Tmed2, were screened for interaction with NcAMA1 protein. Tmed2 protein is involved in vesicle transport in the cytoplasm. By regulating the expression of Tmed2 protein in cells, the possible role of Tmed2 protein in the process of N. caninum invasion was preliminarily identified. When the content of Tmed2 protein in host cells decreased, the number of invading N. caninum parasites increased significantly.

Ethics approval and consent to participate

'Not applicable'

Consent for publication

'Not applicable'

Availability of data and materials

The data sets supporting the results of this article are included within the article and its additional files.

Competing interests

The authors declare that they have no competing interests

Funding

All sources of funding for the National Natural Sciences Foundation of China (No. 32060607,31560690) and the Education Department of Jilin Province (JJKH20170463KJ).

Authors' contributions

LZY and CMJ conceived and designed the study, and critically revised the manuscript. BYW and YNW carried out all of the experiments and drafted the manuscript. YZ and TYZ helped carry out yeast-two-hybrid screening. LZG and BYZ contributed to the revision of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the Education department of Jilin Province (JJKH20200522KJ) and the National Natural Sciences Foundation of China (No. 32060607, 31560690) and the 111 Project (D20034).

Dubey JP, Schares G, Ortega-Mora LM. Epidemiology and control of neosporosis and Neospora caninum. Clin Microbiol Rev. 2007;20 2:323-67.
Dubey JP, Hattel AL, Lindsay DS, Topper MJ. Neonatal Neospora caninum infection in dogs: isolation of the causative agent and experimental transmission. J Am Vet Med Assoc. 1988;193 10:1259-63.
Marugan-Hernandez V. Neospora caninum and Bovine Neosporosis: Current Vaccine Research. J Comp Pathol. 2017;157 2-3:193-200.
Tomley FM, Soldati DS. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Trends Parasitol. 2001;17 2:81-8.
Dubremetz JF, Garcia-Reguet N, Conseil V, Fourmaux MN. Apical organelles and host-cell invasion by Apicomplexa. Int J Parasitol. 1998;28 7:1007-13.
Debache K, Alaeddine F, Guionaud C, Monney T, Muller J, Strohbusch M, et al. Vaccination with recombinant NcROP2 combined with recombinant NcMIC1 and NcMIC3 reduces cerebral infection and vertical transmission in mice experimentally infected with Neospora caninum tachyzoites. Int J Parasitol. 2009;39 12:1373-84.
Debache K, Guionaud C, Alaeddine F, Mevissen M, Hemphill A. Vaccination of mice with recombinant NcROP2 antigen reduces mortality and cerebral infection in mice infected with Neospora caninum tachyzoites. Int J Parasitol. 2008;38 12:1455-63.
Cerede O, Dubremetz JF, Soete M, Deslee D, Vial H, Bout D, et al. Synergistic role of micronemal proteins in Toxoplasma gondii virulence. J Exp Med. 2005;201 3:453-63.
Ossorio PN, Schwartzman JD, Boothroyd JC. A Toxoplasma gondii rhoptry protein associated with host cell penetration has unusual charge asymmetry. Mol Biochem Parasitol. 1992;50 1:1-15.
El Hajj H, Demey E, Poncet J, Lebrun M, Wu B, Galeotti N, et al. The ROP2 family of Toxoplasma gondii rhoptry proteins: proteomic and genomic characterization and molecular modeling. Proteomics. 2006;6 21:5773-84.
Hehl AB, Lekutis C, Grigg ME, Bradley PJ, Dubremetz JF, Ortega-Barria E, et al. Toxoplasma gondii homologue of plasmodium apical membrane antigen 1 is involved in invasion of host cells. Infect Immun. 2000;68 12:7078-86.
Bargieri DY, Andenmatten N, Lagal V, Thiberge S, Whitelaw JA, Tardieux I, et al. Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion. Nat Commun. 2013;4:2552.
Arnott A, Mueller I, Ramsland PA, Siba PM, Reeder JC, Barry AE. Global Population Structure of the Genes Encoding the Malaria Vaccine Candidate, Plasmodium vivax Apical Membrane Antigen 1 (PvAMA1). PLoS Negl Trop Dis. 2013;7 10:e2506.
Giovannini D, Spath S, Lacroix C, Perazzi A, Bargieri D, Lagal V, et al. Independent roles of apical membrane antigen 1 and rhoptry neck proteins during host cell invasion by apicomplexa. Cell Host Microbe. 2011;10 6:591-602.
Donahue CG, Carruthers VB, Gilk SD, Ward GE. The Toxoplasma homolog of Plasmodium apical membrane antigen-1 (AMA-1) is a microneme protein secreted in response to elevated intracellular calcium levels. Mol Biochem Parasitol. 2000;111 1:15-30.
Jia L, Guo H, Liu M, Gao Y, Zhang L, Li H, et al. Construction of an Adenovirus Vaccine Expressing the Cross-reactive Antigen AMA1 for Neospora caninum and Toxoplasma gondii and Its Immune Response in an Animal Model. Iran J Parasitol. 2018;13 2:235-43.
Fields S, Song O. A novel genetic system to detect protein-protein interactions. Nature. 1989;340 6230:245-6.
Gunasekera AM, Wickramarachchi T, Neafsey DE, Ganguli I, Perera L, Premaratne PH, et al. Genetic diversity and selection at the Plasmodium vivax apical membrane antigen-1 (PvAMA-1) locus in a Sri Lankan population. Mol Biol Evol. 2007;24 4:939-47.
Tonkin ML, Crawford J, Lebrun ML, Boulanger MJ. Babesia divergens and Neospora caninum apical membrane antigen 1 structures reveal selectivity and plasticity in apicomplexan parasite host cell invasion. Protein Sci. 2013;22 1:114-27.
Srinivasan P, Beatty WL, Diouf A, Herrera R, Ambroggio X, Moch JK, et al. Binding of Plasmodium merozoite proteins RON2 and AMA1 triggers commitment to invasion. Proc Natl Acad Sci U S A. 2011;108 32:13275-80.
Tyler JS, Boothroyd JC. The C-terminus of Toxoplasma RON2 provides the crucial link between AMA1 and the host-associated invasion complex. PLoS Pathog. 2011;7 2:e1001282.
Hossain ME, Dhawan S, Mohmmed A. The cysteine-rich regions of Plasmodium falciparum RON2 bind with host erythrocyte and AMA1 during merozoite invasion. Parasitol Res. 2012;110 5:1711-21.
Lamarque M, Besteiro S, Papoin J, Roques M, Vulliez-Le Normand B, Morlon-Guyot J, et al. The RON2-AMA1 interaction is a critical step in moving junction-dependent invasion by apicomplexan parasites. PLoS Pathog. 2011;7 2:e1001276.
Besteiro S, Michelin A, Poncet J, Dubremetz JF, Lebrun M. Export of a Toxoplasma gondii rhoptry neck protein complex at the host cell membrane to form the moving junction during invasion. PLoS Pathog. 2009;5 2:e1000309.
Menard R. Gliding motility and cell invasion by Apicomplexa: insights from the Plasmodium sporozoite. Cell Microbiol. 2001;3 2:63-73.
Zhang H, Compaore MK, Lee EG, Liao M, Zhang G, Sugimoto C, et al. Apical membrane antigen 1 is a cross-reactive antigen between Neospora caninum and Toxoplasma gondii, and the anti-NcAMA1 antibody inhibits host cell invasion by both parasites. Mol Biochem Parasitol. 2007;151 2:205-12.
Strating JR, Martens GJ. The p24 family and selective transport processes at the ER-Golgi interface. Biol Cell. 2009;101 9:495-509.
Zakariyah A, Hou W, Slim R, Jerome-Majewska L. TMED2/p24beta1 is expressed in all gestational stages of human placentas and in choriocarcinoma cell lines. Placenta. 2012;33 3:214-9.
Au CE, Hermo L, Byrne E, Smirle J, Fazel A, Simon PH, et al. Expression, sorting, and segregation of Golgi proteins during germ cell differentiation in the testis. Mol Biol Cell. 2015;26 22:4015-32.
Strating JR, Hafmans TG, Martens GJ. Functional diversity among p24 subfamily members. Biol Cell. 2009;101 4:207-19.
Stepanchick A, Breitwieser GE. The cargo receptor p24A facilitates calcium sensing receptor maturation and stabilization in the early secretory pathway. Biochem Biophys Res Commun. 2010;395 1:136-40.
Sun MS, Zhang J, Jiang LQ, Pan YX, Tan JY, Yu F, et al. TMED2 Potentiates Cellular IFN Responses to DNA Viruses by Reinforcing MITA Dimerization and Facilitating Its Trafficking. Cell Rep. 2018;25 11:3086-98 e3.
Straub KW, Cheng SJ, Sohn CS, Bradley PJ. Novel components of the Apicomplexan moving junction reveal conserved and coccidia-restricted elements. Cell Microbiol. 2009;11 4:590-60.

Download PDF

Version 1

posted

You are reading this latest preprint version

Screening and Verification of Host Proteins Interacting with Neospora Caninum AMA1 Using a Yeast Two-hybrid System

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Declarations

References

Status:

Version 1