Statement
The Institutional Research Ethics Committee of The Fifth Affiliated Hospital of Sun Yat-sen University approved the study. All experiments adhered to the principles set forth in the Declaration of Helsinki.
Cell culture and Reagents
The tumor cell lines TCam-2 cells were kindly gifted from Dr. Riko Kitazawa (Department of Diagnostic Pathology, Ehime University Hospital, Matsuyama, Japan). Cells were maintained in complete medium (Roswell Park Memorial Institute Medium-1640 with 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin) in a humidified 5% CO2, 37 °C incubator. In our previous study, we established seminoma TCam-2/CDDP cell lines [14]. Cisplatin was purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies used in this study were METTL3 (Omnimabs, OM284614), BCL2(Santa Cruz, sc-7382), BCLAF1(Omnimabs, OM272372), MCL1(Omnimabs, OM262629), GAPDH (Abcam, ab125247), Caspase-3(Abcam, ab32351), and Cytc(Abcam, ab133504).
M6A RNA Methylation Quantification and MeRIP-qPCR
M6A RNA Methylation Quantification was performed as previously described [4-5]. Briefly, total RNA is bound to strip wells using an RNA high binding solution. N6-methyladenosine (m6A) is detected using a specific capture N6-methyladenosine antibody and detection antibody. The detected signal is enhanced and then quantified colorimetrically by reading the absorbance in a microplate spectrophotometer at a wavelength of 450 nm. The amount of m6A is proportional to the OD intensity measured. EZ-Magna RIP kit (Millipore) was used to evaluate the modification level of m6A in the specific gene according to the manufacturer’s instructions. The enriched RNA-antibody complex was digested with protease to obtain m6A modified RNA. Then qRT-PCR was used to quantify the enriched RNA. Overall, the RNA containing m6A methylated was coated with m6A antibody and immunoprecipitated on magnetic beads A/G.
Western blotting
Cells were lysed in lysis buffer containing protease inhibitors for 30 minutes. The protein concentration of lysates was determined by the bicinchoninic acid assay (Beyotime Biotechnology). An equivalent amount of protein (30μg) of each sample was separated by 10% SDS‐PAGE and then transferred to PVDF membranes. The membranes were blocked with 5% non-fat dry milk in 0.2% Tween-20 in Tris-buffered saline for one h at room temperature and then probed with primary antibodies. After incubated in the secondary antibody, immunoreactivity was detected by the enhanced chemiluminescence method (Affinity biosciences, Cincinnati, OH, USA ).
Cell viability assay
The cytotoxic effect of CDDP on TCam-2/CDDP cells was measured by cell count kit 8 (CCK8) assay. TCam-2 cells were seeded into 96-well plates (Corning Incorporated, Corning, NY, USA) at a density of 1*10^4 cells/well and cultured for 24 hours. Then, cells were cotreated with different concentrations of cisplatin in medium for 0, 24, 48, 72 hours. Thereafter, 10 μL of CCK-8 ( Vazyme Biotech, Nanjing, China) solution was added to each well and mixtures were incubated at 37°C for additional 1 hour. The optical density (OD) at 450 nm was read with a microplate reader (Bio-Tek, Winooski, VT, USA).
Cell apoptosis analysis
Apoptosis was measured by Annexin V-FITC (fluorescein isothiocyanate)/propidium iodide (PI) staining. Briefly, after treatment and incubation for 72 h, cells were collected, washed with PBS, and labeled with Annexin V and propidium iodide in the dark using an Annexin V-FITC apoptosis detection kit (Vazyme Biotech, Nanjing, China). Cell apoptosis was subsequently analyzed by a flow cytometry (Beckman Coulter, Inc. Brea, CA, USA)
Cell invasion assay
A cell invasion assay was performed using Transwell chambers(Corning, NY, USA) with 8-μm pore inserts. Cell suspensions were seeded in the upper chamber, and 500 µL of Dulbecco's Modified Eagle's medium containing fetal bovine serum was added to the lower chamber. The noninvading cells were removed with a cotton-tipped swab after 24 hours of incubation, and the invading cells on the bottom surface of the membrane were stained with 0.1% crystal violet. The invading cells were quantified by counting ten random fields at ×200 magnification.
Quantitative real-time PCR (qPCR)
Total RNA was extracted from cells using the TRIzol reagent of Vazyme Biotech (Nanjing, People's Republic of China) following the manufacturer's protocol. The PCR primer sequences were as follows: METTL3 forward primer 5'-TTGTCTCCAACCTTCCGTAGT-3’, reverse primer 5'-CCAGATCAGAGAGGTGGTGTAG-3’；BCL2 forward primer 5'-GGTGGGGTCATGTGTGTGG-3’, reverse primer 5'-CGGTTCAGGTACTCAGTCATCC-3’；MCL1 forward primer 5'-TGCTTCGGAAACTGGACATCA-3’, reverse primer 5'-TAGCCACAAAGGCACCAAAAG-3’; BCLAF1 forward primer 5'- ATGAGACGACCTTATGGGTACA-3’, reverse primer 5'- AGAGTGCCTTCTATTCCAGACAG-3’; GAPDH forward primer 5'- GGAGCGAGATCCCTCCAAAAT-3’, reverse primer 5'- GGCTGTTGTCATACTTCTCATGG -3’.
.
Cell transfection
SiRNAs for METTL3 and BCL2 were designed. The siRNA sequences were as follows: siRNA-METTL3, sense: 5'-GCAAGUAUGUUCACUAUGATT-3', antisense: 5'-UCAUAGUGAACAUACUUGCAG-3'; siRNA-BCL2, sense: 5'- GCATGCGGCCTCTGTTTGATT-3', antisense: 5'-UCAUAGUGAACAUACUUGCAG-3. Both plasmids and siRNA were transfected with LipofectamineTM 3000 (ThermoFisher, MA, USA) reagent and transfected when the cells met at 70% confluent. The plasmid overexpressing METTL3 has constructed previously [14].
Data processing
Data were analyzed with Prism 7 (GraphPad Software) and presented as mean ± standard deviation (SD). The student's t test was used to analyze the statistical significance of the difference between the two groups. Values are presented as *p < 0.05, **p < 0.01, and ***p < 0.001.