Evidence of Autism Spectrum Disorder Caused By A Mutation In ATRX Gene

doi:10.21203/rs.3.rs-965145/v1

Download PDF

Research

Evidence of Autism Spectrum Disorder Caused By A Mutation In ATRX Gene

https://doi.org/10.21203/rs.3.rs-965145/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: ATRX gene mutations are commonly associated with alpha-thalassaemia mental retardation syndrome (ATRX syndrome). This X-linked disorder is characterized by intellectual disability to a higher or lesser degree, in which alpha-thalassaemia feature is not always present. Here, we report the first case of a Spanish child with a missense ATRX mutation (Thr1621Met) and an Autism Spectrum Disorder (ASD) diagnosis. Except for intellectual disability, no typical signs of ATRX syndrome were found in the patient.

Methods: A 23-month-old male patient was clinically evaluated at the Department of Paediatrics of the “Complejo Hospitalario Universitario de Albacete”, Spain. The baby was diagnosed with ASD according to the established criteria by the American Psychiatric Association (DMS-5). To determine the genetic cause of the pathology, an exome sequencing of a targeted gene panel of 215 genes associated to autism, intellectual disability, and/or seizure was carried out on an Ion Proton (Life Technologies) platform. The mutation was confirmed in the baby and analysed in the rest of the members of the family by PCR-terminator cycle sequencing.

Results: Thr1621Met ATRX hemizygous mutation was identified in the ASD patient. Proband´s mother was identified as an asymptomatic heterozygous carrier and the mutation was not found in the father neither the sister. Thr1621Met change is predicted to have a pathogenic effect and it has been previously associated with ATRX syndrome in only one German family with phenotypic variability.

Limitations: Given the limited number of families with ATRX mutations and, concretely, with Thr1621Met, it is very difficult to establish a genotype-phenotype relationship. Also, we cannot rule out the existence of other genetic, epigenetic and/or environmental factors that may modulate the phenotype of the patient. Furthermore, a functional analysis of Thr1621Met would be necessary to clarify the molecular mechanism by which this mutation causes ASD.

Conclusions: Results suggest one common altered molecular pathway in both, ATRX syndrome and ASD pathologies that opens new research lines in ASD aetiology. Furthermore, the results confirm the extent phenotypic variability associated with ATRX mutations and focus the attention on an exhaustive clinical examination to achieve the most accurate diagnosis.

Molecular Biology

ASD

Alpha thalassaemia

Autism

ATRX

ATRX syndrome

Intellectual disability

SNF2-like family

Thr1621

XNP protein

Autism Spectrum Disorder (ASD) is a complex and heterogeneous group of diseases defined by social communication deficits, and stereotyped or limited activities or interests [1]. Intellectual disability (ID) and seizures are common features as well, although they are not a diagnosis criterion.

Although the cause is not determined in many patients (idiopathic autism), an increasing number of ASD-genetic causes such as cytogenetic abnormalities and single-gene defects, are being identified. ASD is genetically characterized by extensive loci and allelic heterogeneity. Mutations variety includes chromosomal abnormalities, copy number variations and single nucleotide variations (SNVs). Furthermore, epigenetic mechanisms may be related as well as the genetic background, suggesting a cumulative effect of common risk variants [2].

By this time, more than 1.000 genes contribute to ASD risk [3]. The encoded proteins play important roles in neuronal networks linked to synapses, neuronal function and regulation of gene expression throughout chromatin remodelling [4].

ATRX gene (OMIM 300032) is located in the Xq21.1 cytogenetic band, contains 36 exons and encodes an ATP-dependent helicase (XNP protein) belonging to the SNF2 superfamily that is involved in remodelling chromatin, DNA methylation and transcriptional regulation. This chromatin remodeler harbours two principal domains: ADD domain (exons 8-10) and helicase domain (exons 17-31) in which the majority of identified pathological mutations are located [5]. ADD domain, also called plant homeodomain (PHD)-like domain is in the N-terminal of the protein and it has a zinc finger-like structure. This domain is thought to be involved in protein-protein interaction [6]. Helicase domain lies in the C-terminal half of the protein. It is involved in DNA binding and ATP hydrolysis and it is the essential molecular motor for protein function [7].

ATRX mutations usually cause alpha-thalassaemia mental retardation syndrome (ATRX syndrome), a monogenic disease inherited according to a recessive X-linked pattern that shows a wide phenotypic variability. Clinically, ATRX syndrome clearly differs from ASD. It is principally featured by profound learning difficulties, severe expressive language disorder, alpha-thalassaemia, characteristic facial dysmorphism and skeletal abnormalities among other symptoms [8]. However, mild mental retardation or the lack of alpha-thalassaemia have been reported as a part of the strong phenotypic variability found in these patients [9–14]. Furthermore, some patients have exhibited autistic-like behaviour such us little interest or recognition of their environment, avoidance of eye contact or unusual and persistent postures [15]. As far as we know, only one mutation (p.Gly1676Ala) in ATRX has been previously reported in two siblings with ASD diagnosis [16] around the world.

Here, we report an ATRX mutation (p.Thr1621Met) in a child with a typical ASD diagnosis. Mutation was inherited from his healthy mother and no other family members carry the mutation. In addition to ASD, the patient shares some phenotypic manifestations of ATRX syndrome like intellectual deficiency and speech delayed. The results provide evidence of the involvement of ATRX gene in the development of ASD and confirm the wide clinical spectrum associated to ATRX mutations.

Subjects

Four family members of Spanish origin (parents and their two minor children, son and daughter) were recruited in the Department of Paediatrics of the “Complejo Hospitalario Universitario de Albacete”, Spain, for molecular genetic analysis. The study followed the tenets of the Declaration of Helsinki and informed consents were obtained from the parents to study all the family members. The son, proband subject, was clinically evaluated by experienced neuropaediatricians including supplementary examination such as electroencephalogram (EEG) and brain magnetic resonance (BMR). The patient met the following criteria established by the American Psychiatric Association in the Diagnostic and Statistical Manual of Mental Disorders (DMS-5) to ASD diagnosis: a) verbal and/or non-verbal social communication and social interaction deficits, b) stereotyped or limited patterns of behaviour, activities, or interests. The rest of the family members did not report any pathology of interest at the time of the study.

After exome sequencing analysis of the proband, additional clinical evaluation of ATRX syndrome features such as microcephaly, facial dysmorphism, hypotonia, intellectual deficiency, alpha-thalassaemia or urogenital malformations were also examined in detail.

Genetic analysis

DNA extraction

Genomic DNA was extracted from the peripheral leukocytes of all subjects with the E.Z.N.A. Blood DNA kit (Omega Bio-tek) according to the manufacturer’s protocol.

Targeted gene panel

Exome sequencing of a targeted gene panel of 215 genes associated to autism and/or seizure was carried out on an Ion Proton (Life Technologies) platform in the proband patient. The exome capture was designed using the Ion AmpliSeq^TM Exome technology (Life Technologies). The analysis was addressed to the identification of variants included in exonic regions or splice-site junctions that involve a protein modification (nonsense/missense mutations, or nucleotide insertions, deletions or indels) and that were found in more than the 40% of all the reads. Sequencing data were aligned to the reference genome (build 37 of Hg19 genome) using the TMAP-Ion-Aligment software (Life Technologies). Variants were further annotated and analysed using the latest available version of ION Reporter Software (Life Technologies). Approximately, 98% of exonic regions and splice-site junctions were reliably sequenced with at least 10× coverage.

Sanger sequencing: The identified mutation was confirmed in the patient and analysed in the rest of family members by PCR-terminator cycle sequencing. The following PCR primers were designed in the intronic regions, flanking exon 18 of ATRX gene: FW-5’ ATCTCTTTCCCTGTGCCTTG 3’; RV-5’ TTCCCACTGAAATATGCATCAC 3’. Terminator cycle sequencing was carried out using the BigDye (version 3.1) kit (Applied Biosystems) and the products of sequencing reactions were analysed in a 3730xl automated DNA analyser (Applied Biosystems).

Supplementary genetic analysis

In order to rule out other genetic mutations involved in ASD such as chromosomal abnormalities or CNVs, a G-banded karyotype and a CGH-array 400k (Agilent Technologies) were carried out. Due to Fragile X Syndrome is the most consistently reported single-gene associated with ASD, analysis of FMR1 gene was carried out by Southern Blotting using StB 12.3 [17] and OX1.9 [18] probes.

In silico analysis

The evaluation of mutated position by multiple sequence alignment was carried out by Blastp software (U.S. National Library of Medicine). To estimate the functional effect of Thr1621Met mutation, six prediction software [19–25] were used.

Proband phenotype

The Spanish proband was diagnosed with ASD at 23 months old. Family history reported hypothyroidism in treatment, arthrosis, and constitutional leukopenia from the mother, while the father had not diseases of interest. Prenatal history included subclinical hypothyroidism that required treatment with synthetic thyroid hormone during gestation. At 40+5 weeks, a caesarean section was performed due to a disproportion of the foetus. At birth, the patient was in the normal range of development and no growth, facial or neuromuscular abnormalities were observed. However, at 23 months, the patient was referred to the Neuropediatric Service to evaluate a global delayed development. After evaluation, the patient showed intellectual deficiency and an important alteration in the spoken and non-spoken communication (delayed language and minimal visual contact) with a lack of social and emotional reciprocity. Furthermore, he showed nervousness and stereotypies such as winging of arms or movement of objects in a repetitive way. Since then, an ASD diagnosis was stablished. The electroencephalography revealed epileptic activity although seizures have never occurred. After 9 years of follow-up, the patient has a disorder of social communication, with a complete lack of spoken language, and shows restricted and repetitive behavioural patterns, interests and activities.

After ATRX-mutation identification, the patient was clinically re-evaluated and no findings of other typical ATRX-syndrome features, such as alpha-thalassaemia, facial dysmorphisms, or urogenital malformations were reported (Table 1).

Table 1

Clinical features of the patient according to the most relevant ATRX syndrome symptoms.
Phenotypic Features in ATRX syndrome		Clinical manifestation in the proband
Growth
	Low birth weight	NO
	Short stature	NO
	Microcephaly	NO
Facies
	Facial dysmorphism	NO
	Hypertelorism	NO
	Prognathism	NO
	Large forehead	NO
	Small triangular nose	NO
	Short philtrum	NO
	Tented upper lip	NO
	Open mouth	NO
	Full lower lip	NO
Neuromuscular
	Hypotonia	NO
	Epileptogenic activity	YES
	Seizures	NO
Development
	Global delayed development	YES
	Walking delayed	NO
	Speech delayed	YES
	Intellectual deficiency	YES
Other
	Alpha-thalassemia	NO
	Asplenia	NO
	Skeletal abnormalities	NO
	Gut dysmotility	NO
	Cardiac defects	NO
	Urogenital malformations	NO

Genetic analysis

ASD shows an important loci and allelic heterogeneity, ranging from SNVs to chromosomal alterations. Therefore, it was necessary an exhaustive genetic screening study, at different levels, to find out the genetic cause of the pathology in the proband subject. Firstly, a G-banded karyotype was carried out in 20 metaphases to assess severe chromosome structural alterations. The results showed a normal chromosomal formula (46, XY). Secondly, due to the majority of the intellectual disabilities are caused by an expansion of the CGG nucleotide triplet located in the 5’ untranslated region of the FMR1 gene, a Southern Blot analysis with STB 12.3 and OX1.9 probes confirmed that the number of repetitions was in the normal range (5-44 repeats), ruling out FMR1 mutations as the cause of the disorder. Thirdly, potential genomic rearrangements were assessed by a CGH-array and results did not reveal any pathological CNV in the proband.

Finally, an exome sequencing of a targeted gene panel of 215 genes associated to autism, ID, and/or seizure was carried out with the purpose of detecting SNVs or small indels that are not possible to detect with the above techniques. It was analysed a total of 5.213 amplicons covering the selected genes of the panel. Sequencing coverage was 130 reads per base and the 95% of the included amplicons showed a depth of coverage superior to 20x.

Multiple polymorphic variants or single nucleotide polymorphisms (SNPs) were identified and filtered using the following criteria: 1) variant previously described as a polymorphism in population data bases, and 2) no association with clinical phenotype reported in the reviewed literature. After analysis of the results, the c.4862C>T (NM_000489.4) hemizygous mutation was identified in the proband in the exon 18 of ATRX gene, located at Xq21.1 locus. This mutation is predicted to cause a p.Thr1621Met change in the encoded protein.

Segregation analysis by sanger sequencing confirmed the hemizigosity of the patient (II:2) and identified the mother (I:2) as an asymptomatic heterozygous carrier; the mutation was not found in the father (I:1) neither the sister (II:1; Figure 1).

In addition, an in silico analysis was carried out by six bioinformatic predictors (Table 2) in order to clarify the functional effect of the mutation. All the predictors estimated a damaging or deleterious effect of Thr1621Met change supporting the pathogenic nature of the mutation.

Table 2

Bioinformatic analysis of Thr1621Met mutation.
PREDICTOR	SCORE (cutoff)	PROTEIN EFFECT
PROVEAN	-4.13 (-2.5)	Deleterious
PolyPhen2	1 (0.432)	Probably damaging
SIFT	0.010 (0.05)	Damaging
PANTHER	NA	Probably damaging
FATHMM (weighted method)	-3.28 (-1.5)	Damaging
Mutation Taster	NA	Disease causing
NA: not available

The aim of this study was the identification of the genetic cause of ASD in the proband of the studied family. We identified the Thr1621Met mutation in the hemizygote state in the exon 18 of ATRX gene by exome sequencing of a targeted gene panel. The variation has been previously registered (rs122445106) in dbSNP data base and has an allelic frequency less than 0,001% according to the Genome Aggregation Database (gnomAD) [26]. Therefore, it is considered a rare mutation. Thr1621Met is located in the helicase domain of the protein, which includes 17-30 exons [5;27] and is considered a ‘hotspot’ where 33% of sequence alterations are clustered [27]. This domain is the enzymatic core of the protein and plays an important role as a chromatin remodeler [8]. The replacement of threonine by methionine implies an important chemical change, from a hydrophilic amino acid to a hydrophobic one. This alteration could disrupt the structural conformation of helicase domain leading to a loss of function of ATRX.

In the multiple sequences alignment (Table 3), we have compared the ATRX human sequence to ATRX homologue proteins from several species such as rabbit, mouse, zebrafish, tropical clawed frog, or pufferfish. The results showed that the mutated residue is highly conserved among all the species, except for the fruit fly, of which the homologue sequence is quite different from the rest, including the human. Threonine residue is specifically part of the highly conserved downstream helicase motif. In fact, Matthew et. al. reported that mutations located in the two following residues to 1621 (Ala1622 and Leu1623) can particularly destabilize the ATRX protein [7].

Table 3

**Multiple amino acid sequence alignment of ATRX from different species**.
Species	Protein (UniProtKB)	Alignment
H.sapiens	P46100	T	V	L	L	C	D	K	L	D	F	S	T	A	L	V	V	C	P	L	N	T	A	L
P.troglodytes	K7AL80	T	V	L	L	C	D	K	L	D	F	S	T	A	L	V	V	C	P	L	N	T	A	L
O.cuniculus	G1STD0	T	V	L	L	C	D	K	L	D	F	S	T	A	L	V	V	C	P	L	N	T	A	L
M.musculus	Q61687	T	V	L	L	C	D	K	L	D	F	S	T	A	L	V	V	C	P	L	N	T	A	L
G.gallus	E1C8H5	T	V	L	L	C	D	K	L	N	F	R	T	A	L	V	V	C	P	L	N	T	A	L
T.rubripes	H2T6G5	T	L	L	L	C	E	K	L	K	F	S	T	A	L	V	-	-	-	-	-	-	-	-
D.rerio	F1QJ36	T	V	L	L	C	E	K	L	N	F	S	T	A	L	V	V	C	P	L	N	T	V	L
D.melanogaster	Q9GQN5	T	L	L	V	T	R	R	T	G	V	D	R	V	L	I	I	S	P	L	-	-	-	-
X.tropicalis	F7A8S5	T	V	L	L	S	E	K	L	D	F	S	T	A	L	V	V	C	P	L	N	T	V	L
G.aculeatus	G3QAH0	T	V	L	L	S	E	N	L	K	F	R	T	A	L	V	V	C	P	L	N	T	I	L
C.griseus	G3HNY0	T	V	L	L	C	D	K	L	D	F	S	T	A	L	V	V	C	P	L	N	T	A	L
T.nigroviridis	Q4S8S6	T	V	L	L	S	E	N	L	K	F	R	T	A	L	V	I	C	P	L	N	T	V	L
Sequence alignment was generated by Blastp. Threonine residue is highlighted and the amino acids that differ from those of the human sequence are in bold.

Mutations in ATRX gene are typically associated with ATRX syndrome. This pathology is characterized by its wide range of phenotypic variability including alpha-thalassaemia, intellectual deficiency, speech delayed, learning difficulties or facial dysmorphism. Thr1621Met missense mutation has been previously described in only one family from Germany with ATRX syndrome and phenotypic variability among their members like different levels of intellectual disability and presence of alpha-thalassaemia in 3 out of the 4 members. No key signs of ASD diagnosis were reported [28]. Accordingly, as far as we concerned, this is the first time that an ATRX Thr1621 mutation is associated with a typical “nonsyndromic autism” case.

Comparing the clinical features of our case to those of the reported family (Table 4), only two clinical manifestations were shared, speech delayed and intellectual deficiency. Curiously, both features can frequently appear in ASD as well as ATRX syndrome. Other typical ATRX syndrome features such as facial hypotonia or alpha-talassaemia were exclusively manifested in ATRX syndrome family, but not in all members, suggesting other modifier factors in this family. It can also no longer be ruled out the frequent co-morbid manifestations of ASD and the need to examine other families with the same mutation to elucidate the genotype-phenotype relationship. ATRX syndrome and ASD overlapping symptoms suggest a common molecular mechanism through ATRX mutations by which either of these pathologies could develop depending on other genetic, epigenetic and/or environmental factors.

able 4

Comparison of clinical features between the patient reported here and four family members reported by Yntema et al.
Clinical features	López-Garrido et al	Yntema et al
Microcephaly	NO	NO
Facial dysmorphism	NO	No obvious
Hypotonia	NO	YES (facial hypotonia in childhood in some members of the family)
Seizures	NO, but there is epileptogenic activity	NO
Speech delayed	YES	YES
Intelectual deficiency	YES	YES (ranging from borderline to moderate)
Alpha-thalassemia	NO	YES (in 3 out of the 4 members)
Chaotic behaviour	NO	YES
Agressive outburst	NO	YES
Urogenital malformations	NO	NO
All the cases have Thr1621Met mutation in ATRX gene. It is only shown the clinical features reported by Yntema et al.

As far as we know, only another ATRX mutation has been previously reported in two siblings diagnosed with ASD [16] highlighting the multifactorial nature of ASD in contrast to ATRX syndrome monogenetic character. The mutation reported by Gong and co-workers (p.Gly1676Ala) is interestingly located near Thr1621Met, just one exon downstream and in the helicase domain of the protein as well. Unfortunately, Gong et al. did not report any clinical features of the probands beyond an ASD diagnosis, and a phenotypic comparative study could not be complete.

Furthermore, a novel ATRX gene missense mutation (p.His2247Pro) have been recently reported and associated with severe intellectual deficiency without alpha thalassaemia in 3 members of a family [12]. Interestingly, the proband also showed a behavioural disorder associated with stereotypical movements, one of the criteria of ASD diagnosis. This novel mutation is also located in the helicase domain. We can hypothesize ATRX mutations in helicase domain might have an increased susceptibility to develop some sign of ASD while mutations in ADD domain are associated to a severe permanent psychomotor impairment and constant urogenital abnormalities [27]. To confirm this hypothesis, further genotype-phenotype relationship studies would be necessary in a large cohort of patients with ATRX mutations. In any case, we cannot rule out the presence of other altered genes responsible for autism manifestations.

Mutations in the helicase domain have been reported to cause different protein alterations such us destabilization and the resulting dosage change, decrease in ATPase activity by uncoupling ATP hydrolysis or deficiency in DNA translocation [7]. As aforementioned, Thr1621Met also could disrupt the structural conformation of protein, jeopardising the interaction with other chromatin proteins like MeCP2. According to Nan and co-workers, a disruption of MeCP2-ATRX interaction could lead to pathological changes in neural function during brain development [29]. Nevertheless, functional analysis of Thr1621Met would be necessary to clarify the molecular mechanism by which this mutation causes ASD.

The study of chromatin structure has taken an important impetus in recent years and has transcended to the point to understand various human diseases including ASD. ASD-risk genes are often involved in molecular pathways that regulate the synaptic transmission, transcription, and chromatin remodeling during early development. Therefore, we could consider autism like a “synaptic and chromatin-remodeling disorder” [30]. Also, idiopathic autism, which genetic basis are still unclear, could be explain by the above-mentioned epigenetic changes. Carrascosa-Romero and De Cabo-De la Vega stablish a classification of epigenetics of autism in the book "Autism – Paradigms, Recent Research and Clinical Application" [31]. According to these authors, ATP-dependent chromatin remodeling complexes are classified within “Mendelian ASD disorders of the epigenetic machinery in other chromatin remodelers and transcription factors”, where ATRX mutations could be included as a new disorder.

As we have set out throughout the article, there are important limitations in the study due to, mainly, the aetiology and multifactorial condition of the disease. Autism is possibly one of the most complex pathologies; many causes, genetic, epigenetic, and environmental are involved in the development of the disease. Furthermore, depending on the aetiology itself and other modified factors, the phenotype of the individuals can differ among them. Thus, the autism is considered as a spectrum disease. The genetic change detected herein, is a rare mutation that have been previously described only in another family around the world. This makes it difficult to characterise the mutation and stablish a genotype-phenotype relationship, as the two families with Thr1621Met change have different phenotypes as well. It would be desirable to find more families with this ATRX mutation and without another important genomic changes to confirm the ASD phenotype associated to this mutation.

On the other hand, it would be interesting to characterize the molecular pathway by which ATRX mutations cause ASD. According to the results, it is quite clear Thr1621Met is a pathogenic mutation, but we cannot yet predict the prognosis or even the diagnosis of the babies with this mutation. Also, it is possible the ATRX protein domain where mutations are localised, may influence, as we propose herein, in the final phenotype of the individual. In any case, these results open a new line of research to clarify the role of ATRX mutations in the development of ASD and ATRX syndrome.

These results show for the first time, an ASD case caused by the Thr1621Met mutation in ATRX gene. The patient presented a complete ASD symptomatology with comorbid global delayed development and intellectual deficiency, but not other typical signs of ATRX syndrome were identified. This mutation was previously described in a family with ATRX syndrome and phenotypic variability among their members. As far as we know, only two features are shared between both families indicating other genetic, epigenetic and/or environmental factors that contribute to the development of either of pathologies and suggesting, in these cases, one common altered molecular pathway via ATRX gene that opens up new research lines in ASD aetiology. In addition, these results show, once again, the extent phenotypic variability associated with mutations in ATRX gene and focus the attention on an exhaustive clinical examination to achieve the most accurate diagnosis.

ADD ATRX-DNMT3-DNMT3L domain

Ala Alanine

ASD Autism spectrum disorder

ATP Adenosine triphosphate

ATRX Alpha-thalassaemia mental retardation

BMR Brain magnetic resonance

CGH Comparative genome hibridation

CNV Copy number variations

DMS Diagnostic and statistical manual of mental disorders

DNA Deoxyribonucleic Acid

EEG Electroencephalogram

ExAc Exome aggregation consortium

Fw Forward

Gly Glycine

His Histidine

Met Methionine

PCR Polymerase Chain Reaction

PHD Plant Homeodomain

Pro Proline

Rv Reverse

SNPs Single nucleotide polymorphisms

SNVs Single nucleotide variations

Thr Threonine

TMAP Torrent mapping alignment program

Ethics approval and consent to participate

Informed consent was obtained from all participating individuals.

Consent for publication

Not applicable.

Availability of data and materials

All the datasets generated by authors during the current study are included in this published article. The datasets generated for the supplementary genetic analysis and NGS sequencing are not publicly available due to restrictions are applied by the service/company that performed these analysis but are available from the authors upon reasonable request and with permission of these services.

Competing interests

The authors declare that they have no competing interests.

Funding

Authors acknowledge funding by the Health Service of Castilla-La Mancha, which has a collaboration agreement with the Medical Genetics Group (University of Castilla-La Mancha) to financial support of genetic studies of the patients.

Authors' contributions

MPLG carried out the analysis and interpretation of the data, and manuscript writing. MCCR recruited the family, participated in the data acquisition, did the clinical examination to the individuals and contributed to the conception and design of the study. MMH and JRA contributed to the data analysis. FSS contributed to the conception and design of the study, and interpretation of the results. All the authors contributed to manuscript revisions and read and approved the final manuscript.

Acknowledgements

Authors are extremely grateful to the family participant in the study. We would also like to thank the nurses of the Paediatrics Service of University Hospital of Albacete for blood extractions.

Battle DE. Diagnostic and Statistical Manual of Mental Disorders (DSM). Codas. 2013;25(2):191–2.
Bourgeron T. From the genetic architecture to synaptic plasticity in autism spectrum disorder. Nat Rev Neurosci. 2015;16(9):551–63.
Wisniowiecka-Kowalnik B, Nowakowska BA. Genetics and epigenetics of autism spectrum disorder-current evidence in the field. J Appl Genet. 2019;60(1):37–47.
Ronan JL, Wu W, Crabtree GR. From neural development to cognition: unexpected roles for chromatin. Nat Rev Genet. 2013;14(5):347–59.
Gibbons RJ, Wada T, Fisher CA, et al. Mutations in the chromatin-associated protein ATRX. Hum Mutat. 2008;29(6):796–802.
Bienz M. The PHD finger, a nuclear protein-interaction domain. Trends Biochem Sci. 2006;31(1):35–40.
Mitson M, Kelley LA, Sternberg MJ, Higgs DR, Gibbons RJ. Functional significance of mutations in the Snf2 domain of ATRX. Hum Mol Genet. 20111;20(13):2603-10.
Gibbons RJ, McDowell TL, Raman S, et al. Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nat Genet. 2000;24(4):368–71.
Moncini S, Bedeschi MF, Castronovo P, et al. ATRX mutation in two adult brothers with non-specific moderate intellectual disability identified by exome sequencing. Meta Gene. 2013;1:102–8.
Basehore MJ, Michaelson-Cohen R, Levy-Lahad E, et al. Alpha-thalassemia intellectual disability: variable phenotypic expression among males with a recurrent nonsense mutation - c.109C>T (p.R37X). Clin Genet. 2015;87(5):461–6.
Hamzeh AR, Nair P, Mohamed M, et al. A novel missense mutation in ATRX uncovered in a Yemeni family leads to alpha-thalassemia/mental retardation syndrome without alpha-thalassemia. Ir J Med Sci. 2016;9.
Bouazzi H, Thakur S, Trujillo C, Alwasiyah MK, Munnich A. Novel ATRX gene damaging missense mutation c.6740A>C segregates with profound to severe intellectual deficiency without alpha thalassaemia. Indian J Med Res. 2016;143(1):43–8.
Guerrini R, Shanahan JL, Carrozzo R, Bonanni P, Higgs DR, Gibbons RJ. A nonsense mutation of the ATRX gene causing mild mental retardation and epilepsy. Ann Neurol. 2000;47(1):117–21.
Jensen LR, Chen W, Moser B, et al. Hybridisation-based resequencing of 17 X-linked intellectual disability genes in 135 patients reveals novel mutations in ATRX, SLC6A8 and PQBP1. Eur J Hum Genet. 2011;19(6):717–20.
Gibbons R. Alpha thalassaemia-mental retardation, X linked. Orphanet J Rare Dis. 2006;1:15.
Gong X, Bacchelli E, Blasi F, et al. Analysis of X chromosome inactivation in autism spectrum disorders. Am J Med Genet B Neuropsychiatr Genet. 2008;147B(6):830–5.
Oberlé I, Rousseau F, Heitzc D, Kretz C, Devys D, Hanauer A, Boué J, Bertheas MF, Mandel JL. Instability of a 550-Base Pair DNA Segment and Abnormal Methylation in Fragile X Syndrome. Science. 1991;252:1097–102.
Snow K, Doud L, Hagerman R, Hull C, Hirst MC, Davies KE, Thibodeau SL. Analysis of mutations at the fragile X locus using the DNA probe Ox1.9. 1992;43(1-2):244–254.
Choi Y, Chan AP. PROVEAN web server: a tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics. 2015;31(16):2745–7.
Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7(4):248–9.
Sim NL, Kumar P, Hu J, Henikoff S, Schneider G, Ng PC. SIFT web server: predicting effects of amino acid substitutions on proteins. Nucleic Acids Res. 2012;40(Web Server issue):W452-W457.
Shihab HA, Gough J, Cooper DN, et al. Predicting the functional, molecular, and phenotypic consequences of amino acid substitutions using hidden Markov models. Hum Mutat. 2013;34(1):57–65.
Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods. 2014;11(4):361–2.
Bromberg Y, Yachdav G, Rost B. SNAP predicts effect of mutations on protein function. Bioinformatics. 2008;24(20):2397–8.
Mi H, Muruganujan A, Ebert D, Huang X, Thomas PD. PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res. 2019;47(D1):D419–26.
Karczewski KJ, Francioli LC, Tiao G, et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature. 2020;581:434–43. https://doi.org/10.1038/s41586-020-2308-7.
Badens C, Lacoste C, Philip N, et al. Mutations in PHD-like domain of the ATRX gene correlate with severe psychomotor impairment and severe urogenital abnormalities in patients with ATRX syndrome. Clin Genet. 2006;70(1):57–62.
Yntema HG, Poppelaars FA, Derksen E, et al. Expanding phenotype of XNP mutations: mild to moderate mental retardation. Am J Med Genet. 2002;110(3):243–7.
Nan X, Hou J, Maclean A, et al. Interaction between chromatin proteins MECP2 and ATRX is disrupted by mutations that cause inherited mental retardation. Proc Natl Acad Sci U S A. 2007;104(8):2709–14.
Kubota T, Mochizuki K. Epigenetic Effect of Environmental Factors on Autism Spectrum Disorders. 2016;13(5).
Carrascosa-Romero MC. De Cabo- De La Vega C. The genetic and epigenetic basis involved in the pathophysiology of ASD: Therapeutic implications. InTech book titled "Autism – Paradigms, Recent Research and Clinical Application", ISBN 978-953-51-3080-2, edited by Michael Fitzgerald and Jane Yip. InTech, 2017. Chapter 8:115-182. http://www.intechopen.com/articles/show/title/the-genetic-and-epigenetic-basis-involved-in-the-pathophysiology-of-asd-therapeutic-implications.

Download PDF

Version 1

posted

You are reading this latest preprint version

Evidence of Autism Spectrum Disorder Caused By A Mutation In ATRX Gene

Status:

Version 1

Abstract

Figures

Background

Methods

Subjects

Genetic analysis

Results

Proband phenotype

Genetic analysis

Discussion

Limitations

Conclusions

Abbreviations

Declarations

Not applicable.

References

Status:

Version 1