Antibiotic Resistant, Virulence-associated Genes, Biofilm and Efflux Pump Gene Expression and Molecular Typing of Klebsiella Pneumoniae Strains Recovered from Clinical Samples

doi:10.21203/rs.3.rs-96879/v1

Background

Multidrug-resistant (MDR) Klebsiella pneumoniae strains are one of the most important life-threatening nosocomial pathogens. In the current study, antibiotic resistant, virulence-associated genes, gene expression of efflux pumps and biofilm genes as well as molecular typing of K. pneumoniae strains were investigated. A total of 505 clinical specimens were collected from hospitalized patients and K. pneumoniae strains were isolated by standard microbiological methods. Antibiotic resistant profile, prevalence of virulence associated genes, biofilm and efflux pump genes were investigated. The gene expression analysis of biofilm and efflux pump genes were analused quantitative Real Time PCR. Moreover, molecular typing of K. pneumoniae strains using Repetitive element sequence-based PCR (rep-PCR) technique was also carried out.

Results

One hundred K. pneumoniae strains out of 500 clinical samples were isolated and the highest prevalence of resistance was observed against ciprofloxacin (75%), Trimethoprim-sulfamethoxazole (73%) and Nitrofurantoin (38%). Virulence associated genes including entB, traT and rmpA were found in 80%, 62% and 48%, respectively. Gene prevalence for biofilm association gene including mrkA, fimH and mrkD were 42% for all genes. The AcrAB, TolC and mdtK efflux pump genes were observed in 41%, 33% and 26%, respectively. In addition, most MDR strains formed biofilm, as well as, AcrAB efflux pump and mrkA biofilm gene expression was up-regulated in MDR K. pneumoniae strains and a significant statistically association was also observed between MDR strains and high expression of efflux pump and biofilm genes. In addition, the K. pneumoniae strains differentiated into 11 different genetic clusters by rep-PCR analysis.

Conclusions

High prevalence of resistance, presence of diver’s virulence factors and high level of efflux pump and biofilm gene expression in diverse clones of K. pneumoniae strains pose an important public health issue.

Infectious Diseases

General Microbiology

Klebsiella pneumoniae

antibiotic resistant

efflux pumps

Biofilm

gene expression

rep-PCR

Klebsiella pneumoniae is a Gram-negative pathogen belonging to the Enterobacteriaceae family [1]. K. pneumoniae can cause various infections such as urinary tract infections, pneumonia and bloodstream infections and it is considered as an important nosocomial pathogen in Iran [2]. K. pneumoniae has recently attracted the attention of researchers due to the increased severity of infections, antibiotic resistance and treatment deficiencies [3, 4]. The increase in multidrug-resistant (MDR) K. pneumoniae in recent years is mainly due to the indiscriminate use of antibiotics to treat and prevent infections caused by this bacterium [5]. K. pneumoniae uses a variety of mechanisms to resist antibiotics [6]. One of the important mechanisms for creating the MDR is efflux pump systems and biofilm formation capacity [7]. Efflux pumps are protein based structure which capable extrude the different toxic substances out of cells and the AcrAB-TolC efflux pump system which belongs to the Resistance Nodulation Division (RND) efflux pump which is an important cause of MDR of K. pneumoniae strains occurrence [8–11]. The AcrAB-TolC efflux pump is composed a periplasmic component (AcrA), a transporter located in the inner membrane (AcrB) and an outer membrane compartment (TolC). The AcrAB-TolC efflux pump plays an important role in developing resistance to various antibiotics such quinolones, tetracycline, and chloramphenicol in MDR strains of K. pneumoniae [12]. The ability to form biofilms in K. pneumoniae strains, allows it to protect against the host immune system and antibiotics in MDR isolates and there are a lot of biofilm related genes including mrk (type 3 fimbriae), fimH-1 (type 1 fimbrial adhesion) [13, 14]. Studies show that the efflux pump plays an important role in antibiotic resistance and biofilm formation [15]. There are several studies showed a correlation of K. pneumoniae antibiotic resistance, efflux pump and biofilm formation ability [16]. In the study of Subramanian et al, 2012, indicated that 80% of biofilm forming isolates from 100 clinical samples showed an MDR phenotype [17]. Various Virulence factors such as those encoding regulators of mucoid phenotype A (rmpA), bacteriocin biosynthesis [enterobactin (entB), and serum resistance-associated outer membrane lipoprotein (traT) play an important role in the pathogenicity of K. pneumoniae strains [18].

Molecular typing of K. pneumoniae strains can be used to prevent infection in the hospital and also to find the dominant genotype among the isolates can be useful in finding the source of infection and applying prevention protocols [19, 20]. Due to the high prevalence of MDR strains of K. Pneumoniae in Iran, the aim of this study was to investigate the antibiotic resistance profile and distribution of virulence genes in K. Pneumoniae strains, efflux pump and biofilm gene expression, as well as, molecular typing of K. pneumoniae strains using Repetitive element sequence-based PCR (rep-PCR).

Bacterial isolates and identification

A total of 505 clinical specimens including urine, blood, sputum and cerebrospinal fluid (CSF) were collected from hospitalized patients were admitted to Baghiatallah and Imam Khomeini hospitals in Iran from January 2018 to July 2019. The K. pneumoniae strains were identified using conventional microbiological tests including catalase, MR-VP (methyl red – Voges Proskauer), lysine iron agar, Kligler agar, phenylalanine agar, urea agar, SIM (sulfide, indole, motility), blood agar, and MacConkey agar [21]. The isolated strains were stored at -20 ⁰C in brain heart infusion broth containing 20% glycerol for further investigation.

Antimicrobial susceptibility test

Antibiotic susceptibility of K. pneumoniae strains was evaluated according to the Clinical and Laboratory Standards Institute (CLSI) standard based on to Kirby-Bauer disk diffusion method [22]. The antimicrobial susceptibility assays to 17 antibiotics were performed using commercially available antibiotics including ceftazidime (30 μg), cefotaxime (30 μg), cefoxitin (30 μg), ceftriaxone (30 μg), tobramycin (10 μg), gentamicin (10 μg), streptomycin (30 μg), nalidixic acid (30 μg), ciprofloxacin (5 μg), Imipenem (10 μg), co-trimoxazole (1.25/23.75 μg), chloramphenicol (30 μg), Amoxicillin/Clavulanic acid (AMC, 20/10 μg), Meropenem (10 μg), clindamycin (30 μg), polymixin B (10 μg), tetracycline (30 μg) (MAST, Group Ltd., Merseyside, UK). The plates were incubated at 37 ⁰C for 24 hours and subsequently, the inhibition zone diameters were recorded in millimeter and interpretation was done based on CLSI. K. pneumoniae ATCC 13883 was used as a control in this study. Multidrug-resistant (MDR) strains were identified based on their resistance to at least one drug in three different groups of antibiotics.

Phenotypic detection of efflux pump

The phenotypic and qualitative detection of the efflux pump in Klebsiella pneumoniae strains was performed by Cartwheel method. Briefly, the plates of Muller Hinton Agar culture media containing ethidium bromide were prepared and the culture medium was divided into 8 parts and the bacteria in 0.5 McFarland turbidity concentration were streaked on plates. After 24 h of incubation at 37 ⁰C, the plates were studied under UV transilluminator. The strains that had efflux pumps did not show emission of fluorescence [23].

Phenotypic detection of biofilm formation

Phenotypic detection of biofilm formation was performed using Congo red agar test. Briefly, the K. pneumoniae strains was cultured in Brain Heart Infusion agar enriched with 5% (w/v) sucrose and Congo red based on Freeman et al. 1989. The K. pneumoniae strains which formed biofilm exhibited a dry dark crystalline colonies and considered as exopolysaccharides producers [24].

Quantitative detection of biofilm

Quantitative biofilm detection test was performed by plate microtiter method in 96 house plate. In summary, first 100 μl of 24-hour culture of strains with OD = 0.1 were added into wells. After 24 h incubation, each well was washed twice with PBS and then, stained with crystal violet for 15 min.

Finally, the stained cells were solubilized in 33% (v/v) acetic acid and their adsorption was read at 570 nm OD 570 nm. Based on the type of biofilm, the strains of biofilm former were divided into three categories: strong biofilm, moderate biofilm, weak biofilm and negative biofilm producers. In addition, the standard strain K. pneumoniae ATCC 13833 and LB broth was considered as a positive and negative control, respectively [25].

Molecular detection of virulence associated genes

The genomic DNA of the strains was extracted by the DNA extraction kit (Bioneer, Korea) according to the manufacturer's protocol. The frequency of entB, Trat and rmpA virulence gene, mdtk, tolC and AcrAB efflux pump, fimH-1, mrkA and mrkB biofilm associated genes were detected by PCR. The PCR conditions were as follow: Initial denaturing at 94 ⁰C for 5 min followed by 30 cycles, each cycle contained 1 min at 94 ⁰C for denaturation, 30 second for annealing (Table 1) and 60 S for extension steps and finally one cycle for final extension at 72 ⁰C for 10 min. The primer of target genes are given in Table 1.

Table 1

The primer sequences of target genes which used in this study.
Target gene	Primer sequence (5^/ to 3^/)	Annealing Temperature (⁰C)	Reference
AcrAB	F ATCAGCGGCCGGATTGGTAAA R CGGGTTCGGGAAAATAGCGCG	53	[26]
TolC	F ATCAGCAACCCCGATCTGCGT R CCGGTGACTTGACGCAGTCCT	51	[26]
Mdtk	F GCGCTTAACTTCAGCTCA R GATGATAAATCCACACCAGAA	43	[26]
mrkA	F ACGTCTCTAACTGCCAGGC R TAGCCCTGTTGTTTGCTGGT	55	[16]
mrkD	F CCACCAACTATTCCCTCGAA R ATGGAACCCACATCGACATT	43	[27, 28]
fimH	F GCCAACGTCTACGTTAACCTG R ATATTTCACGGTGCCTGAAAA	43	[26]
entB	F CTGCTGGGAAAAGCGATTGTC R AAGGCGACTCAGGAGTGGCTT	49	[26]
traT	F GGTGTGGTGCGATGAGCACAG R CACGGTTCAGCCATCCCTGAG	55	[28]
rmpA	F ACTGGGCTACCTCTGCTTCA R CTTGCATGAGCCATCTTTCA	53	[29]
16S rRNA	F AGCCGACCTGAGAGGGTGA R TCTGGACCGTGTCTCAGTTCC	55	[30]

Gene expression analysis of AcrAB and mrkA gene

AcrAB efflux pump and mrkA biofilm gene expression analysis was done using quantitative Real Time PCR method in K. pneumoniae strains. Briefly, 100 µl of each bacterium was added into 96 well plate and incubated for 18 h at 37 ⁰C aerobically. Then, each well was washed using PBS and adherent cells were scraped off using LB broth. Subsequently, total RNA of collected strains were extracted using an RNA extraction kit (Qiagen, USA) according to instruction protocol.

The extracted RNA was converted to complementary DNA (cDNA) by a cDNA synthesis kit (Fermentase, Lithuania) based on manufacturer’s instructions. In order to perform the Real Time PCR, each cDNA was used as a template in 20 µl final volume containing 2 μl cDNA, 10 pmol of each primer (Table 1), and 10 µl Power SYBR Green PCR Master Mix (Applied Biosystems) using Bioneer Real-Time PCR equipment (Korea). The 16S rRNA was used as a housekeeping gene to normalize the levels of mRNA expression and the relative expression of AcrAB efflux pump gene was calculated using ΔΔCт method.

Molecular typing of MDR K. pneumoniae strains

Molecular typing of K. pneumoniae strains was done using the Repetitive element sequence-based PCR (rep-PCR) method. The rep-PCR was performed using two following primers: Forward: REP1 5’– III ICG ICG ICA TCI GGC-3’ Reverse: REP2 5’– ICG ICT TATCIG GCC TAC-3’ as described previously. The PCR amplification products were visualized using electrophoresis on 1.5% agarose gel and stained with safe red. Finally, the banding patterns and size were determined via Image Lab 4.0. The obtaining results were analyzed by gel compare II software using Dice correlation coefficient and the UPGMA method [31].

Statistical Analysis

All tests of this study are repeated three times and one way ANNOVA test was used for statistical analysis. In addition, P <0.05 was also considered significant.

Isolation and antimicrobial susceptibility pattern of K. pneumoniae strains

A total of 100 K. pneumoniae isolates were collected from 505 clinical samples. The 100 K. pneumoniae strains were recovered from specimens of urine (n=70), blood (n=20), Sputum (n=6) and cerebrospinal fluid (CSF, n=4) based on routine microbiological methods. Among 100 clinical strains of K. pneumoniae, 75 (75%), 73 (73%) and 68 (68%) of strains were resistant to ciprofloxacin, Trimethoprim-sulfamethoxazole and Nitrofurantoin, respectively and 28 (28%), 52 (52%) strains were susceptible to streptomycin and imipenem, respectively (Table 2). In addition, 92 (92%) strains revealed MDR phenotypes and most MDR strains were resistant to imipenem, meropenem and beta-lactam antibiotics. The studied strains were categorized into 25 antimicrobial resistant patterns (Table 2).

Phenotypic detection of biofilm formation and efflux pump

Phenotypic detection of biofilm formation was done using Congo red agar test and our results showed that 77% (77 strains) of isolates exhibited black colonies, which presumably indicate biofilm formation (Fig 1A). The other strains formed white colonies which reflecting no biofilm formation. Moreover, the Cartwheel results showed that 90% (90 isolates) of strains had efflux pumps (Fig 1B).

Table 2

Antimicrobial sensitivity, biofilm formation and efflux pump patterns of *K. pneumoniae* strains.
Isolates NO.	Antibiotic resistant pattern	Anti-biotype (AB)	MDR	Biofilm former	Mean OD 570	Phenotypic efflux pump
10, 17, 23, 73, 92, 98	CTX, CAZ, CRO, FOX, NA, CP, FM, TE, S, GM	AB1	+	+	2.63±0.14	+
15, 20	CTX, CAZ, CRO, FOX, NA, CP, FM, TMP	AB2	+	-	0.025±0.03	+
1, 6, 13, 25	CTX, CAZ, CRO, FOX, TMP, GM, S	AB 3	+	+	2.13±0.19	+
4, 12, 21, 74, 77, 94	CAZ, FOX, FM, TE, TMP, S	AB 4	+	+	3.52±0.21	+
18, 35, 49	CTX, CAZ, CRO, FOX, FM, TMP	AB 5	+	+	0.76±0.06	+
3, 16, 22	CTX, CAZ, CRO, NA, CP	AB 6	+	+	0.38±0.08	+
8, 45, 75	CTX, CAZ, CRO, FOX, NA, CP, FM, TE	AB 7	+	+	2.69±0.17	+
5, 41, 76	CTX, CAZ, CRO, FOX, NA, CP, AMC, CF, S, FM, TMP, IMP, GM, MEN	AB 8	+	+	3.4±0.12	+
19, 31, 72	CTX, CAZ, CRO, NA, CP, FM, TMP, GM, S	AB 9	+	+	1.8±0.07	-
7	AMC, S, CF, TMP	AB 10	+	+	0.17±0.16	+
9, 28, 87	FM, CF, AMC, K, GM, TMP, CP, AN, FOX, CTX, CRO, CAZ	AB 11	+	+	0.81±0.007	+
24, 26, 40	S, CF, AMC, FM, IPM, TMP, MEN, NA, CP	AB 12	+	-	0.16±0.003	+
14, 39	CL, TE, PB, AN, TMP, GM, K, S, FM, AMC, CF	AB 13	+	+	0.15±0.006	+
41, 59, 61, 93	AMC, CF, FM, PB, CL, TE	AB 14	+	+	0.94±0.007	-
36, 43	CP, TE, NA, FM, MEN, TMP, CF, AMC	AB 15	+	+	0.16±0.006	+
53, 81, 96	CF, AMC, MEN, TMP, IPM, CP, NA	AB 16	+	+	0.20±0.13	+
27, 30, 62, 88	FM, AMC, CF, IPM, AN, MEN, GM, TMP, CP, TE, NA, CL	AB 17	+	+	0.19±0.001	+
2, 11, 60, 78, 100	CF, AMC, TMP, CP, TE, NA	AB 18	+	+	0.13±0.006	+
50, 80, 85, 86	AMC, FM, CF, CP, TE, NA, MEN, IPM, TMP, GM, AN	AB 19	+	+	2.13±0.003	+
48, 52, 58, 65	AMC, S, CF, FM, IPM, MEN, CP, NA	AB 20	+	+	3.82±0.009	+
33, 47, 71, 56, 83, 69	CF, K, FM, AMC, GM, MEN, IPM, AN, TMP, NA, TE, CP	AB 21	+	+	0.19 ±0.007	+
34, 42, 99	AMC, CF, FM, IMP, MEN, TMP, CP, NA, TE	AB 22	+	+	1.45±0.008	-
44, 50, 54, 7, 66, 79, 97, 63, 64, 70, 82	CAZ, CRO, FOX, K, FM, AMC, CF, AN, TMP, GM, IMP, MEN, CP, TE, NA	AB 23	+	-	0.02±0.002	+
29, 32, 51, 55, 57, 68, 84	CP, TE, NA, TMP, GM, IMP, MEN, AMC, FM, CF, CAZ, CTX, CRO, FOX	AB 24	+	-	0.029±0.001	+
30, 89, 90, 91, 37, 38, 46, 95	CF, AMC	AB 25	-	+	0.56±0.001	+
CF: Chloramphenicol, AMC: Amoxicillin-clavulanic acid, FOX: Cefoxitin, CRO: Cefteriaxon, CTX: Cefotaxime, CAZ: Ceftazidime, FM: Nitrofurantoin, MEN: Meropenem, IMP: Imipenem, GM: Gentamycin, TMP: Trimethoprim-sulfamethoxazole, NA: Nalidixic acid, TE: Tetracycline, CP: Ciprofloxacin, S: Streptomycin, K: Kanamycin, CL: Clindamycin, PB: Polymixin B, S: Streptomycin,

Quantitative biofilm production

The results of quantitative biofilm production test is shown in Table 2 as mean OD 570 values. According to OD values among 77% biofilm producers, 50 isolates (71%) were categorized strong biofilm former (OD> 0.204), 16 (20%) as moderate biofilm former (0.102<OD<0.204) and 11 isolates (14%) as weak biofilm former (0.0551<OD<0.102). There are a significant between MDR phenotype, biofilm formation and efflux pump among K. pneumoniae strains (P<0.05). Moreover, there was a significant correlation between biofilm formation in isolates recovered from urine comparing to other type specimens (P<0.05).

Frequency of biofilm, efflux pump and virulence associated genes

The prevalence of biofilm, efflux pump and virulence associated genes are given in Table 3. The mrkA, mrkD and fimH genes encoding type 1 and type 3 fimbrial adhesion engage in biofilm formation were present in all biofilm former strains. Moreover, the efflux pump genes including AcrAB, TolC and mdtK were observed 41 (41%), 33 (33%) and 26 (26%) strains, respectively. The AcrAB was more prevalent in K. pneumoniae strains comparing to other efflux pump genes. In addition, the AcrAB efflux pump gene was more prevalent in urine samples comparing to other clinical specimens.

In addition, the virulence related genes including enterobactin biosynthesis gene (entB), outer membrane protein coding gene (traT) and mucoid phenotype A (rmpA) was seen in 80 (80%), 62 (62%) and 48 (48%) strains, respectively. As reported in Table 3, analysis of selected genes showed that biofilm was more pronounced among virulence associated gene positive than among negative strains. The entB virulence gene was detected in all blood, CSF and sputum isolates. There were 8 virulence profiles (V1-V8) Based on virulence detected gene and V1 was the most prevalent virulence type.

Table 3

Biofilm, efflux pump and virulence association genes among *K. pneumoniae* strains.
Isolate NO	Biofilm association genes			Efflux pump genes			Virulence association gene			Virulence gene Type	Type of samples
Isolate NO	*mrkA*	*mrkD*	*fimH*	*AcrAB*	*TolC*	*mdtK*	*entB*	*TraT*	*rmpA*	Virulence gene Type	Type of samples
1	+	+	+	-	+	-	+	+	-	V1	Urine
2	+	+	+	+	+	+	+	+	+	V2	Urine
3	+	+	+	-	+	-	+	+	+	V2	Urine
4	+	+	+	+	-	-	+	+	+	V2	Urine
5	+	+	+	+	-	+	-	+	-	V3	Urine
6	+	+	+	-	-	+	+	+	-	V1	Urine
7	+	+	+	-	+	-	+	-	+	V4	Urine
8	+	+	+	+	-	+	+	-	+	V4	Urine
9	+	+	+	-	-	-	-	+	+	V5	Urine
10	+	+	+	-	+	+	+	+	-	V1	Urine
11	+	+	+	+	+	-	+	+	-	V1	Urine
12	+	+	+	-	-	-	+	+	-	V1	Urine
13	+	+	+	-	+	-	+	+	-	V1	Urine
14	+	+	+	-	-	-	-	+	-	V3	Urine
15	+	-	-	+	+	-	+	-	+	V4	Urine
16	-	+	+	-	-	+	+	+	+	V2	Urine
17	+	+	+	-	-	+	+	+	+	V2	Urine
18	+	+	+	+	+	+	+	+	+	V2	Urine
19	-	+	+	-	-	-	-	+	-	V3	Urine
20	+	-	-	+	-	-	+	+	-	V1	Urine
21	+	+	+	-	-	-	+	+	-	V1	Urine
22	+	+	+	+	+	-	-	+	-	V3	Urine
23	+	+	+	-	-	-	+	+	-	V1	Urine
24	+	+	+	+	-	-	-	-	+	V6	Urine
25	+	+	+	-	+	-	+	+	+	V2	Urine
26	+	+	+	-	+	-	-	+	+	V5	Urine
27	+	+	+	-	-	-	-	+	-	V3	Urine
28	-	+	+	-	+	-	+	+	-	V1	Urine
29	-	-	-	+	-	-	+	+	+	V2	Urine
30	+	-	-	-	-	-	-	+	+	V5	Urine
31	+	+	+	+	-	-	+	+	+	V2	Urine
32	+	-	-	+	-	+	-	-	-	V7	Urine
33	-	+	+	+	-	+	+	+	-	V1	Urine
34	+	+	+	-	+	-	+	+	-	V1	Urine
35	-	+	+	-	-	-	-	+	-	V3	Urine
36	-	+	+	+	-	-	+	+	-	V1	Urine
37	+	-	-	+	-	-	-	+	-	V3	Urine
38	+	-	-	+	-	-	+	+	-	V1	Urine
39	+	+	+	+	+	-	+	+	-	V1	Urine
40	+	+	+	-	-	+	+	-	-	V8	Urine
41	+	+	+	-	-	-	+	-	+	V4	Urine
42	+	+	+	-	-	-	+	-	+	V4	Urine
43	+	+	+	-	-	+	+	-	+	V4	Urine
44	+	+	+	+	+	-	-	-	+	V6	Urine
45	+	+	+	+	+	-	+	+	+	V2	Urine
46	+	+	+	+	+	-	+	+	+	V2	Urine
47	+	+	+	-	-	+	+	+	-	V1	Urine
48	+	+	+	-	-	-	+	-	-	V8	Urine
49	+	+	+	-	+	+	-	-	-	V7	Urine
50	+	-	-	+	-	+	+	-	+	V4	Urine
51	-	+	+	-	+	-	+	+	+	V2	Blood
52	+	+	+	+	+	-	+	+	+	V2	Urine
53	+	+	+	+	-	+	+	+	+	V2	Sputum
54	+	+	+	-	+	-	+	-	+	V6	Blood
55	+	+	+	-	-	-	+	-	+	V4	Blood
56	+	+	+	+	-	+	+	-	+	V4	Blood
57	+	+	+	-	-	-	-	-	+	V4	Urine
58	+	+	+	-	+	+	+	+	-	V1	Blood
59	+	+	+	-	-	-	-	+	-	V3	Urine
60	+	+	+	-	+	+	+	+	-	V1	Urine
61	+	+	+	-	-	-	+	+	+	V2	Blood
62	+	+	+	-	-	-	+	+	+	V2	CSF
63	+	+	+	-	+	+	-	-	+	V6	Urine
64	+	+	+	-	+	+	+	-	+	V4	Sputum
65	+	+	+	-	-	-	+	-	+	V4	Blood
66	+	+	+	-	-	-	+	-	-	V8	Sputum
67	+	+	+	-	+	-	-	-	-	V7	Urine
68	+	+	+	-	+	-	+	+	-	V1	Blood
69	+	+	+	+	-	-	+	+	-	V1	Urine
70	+	+	+	+	-	-	+	+	+	V2	Blood
71	+	+	+	+	-	-	-	-	-	V7	Urine
72	+	+	+	-	-	-	+	-	-	V8	CSF
73	+	+	+	+	-	-	+	-	+	V4	Urine
74	+	+	+	-	-	-	-	+	-	V1	Urine
75	+	+	+	+	+	-	+	+	-	V3	Blood
76	+	+	+	+	+	-	+	-	+	V4	Urine
77	-	+	+	-	-	-	+	+	-	V1	Blood
78	+	+	+	-	-	-	+	-	-	V8	Urine
79	+	+	+	-	-	-	+	-	-	V8	Blood
80	+	+	+	+	-	-	+	-	-	V8	Blood
81	+	+	+	-	-	-	+	+	+	V2	CSF
82	+	+	+	+	-	-	+	-	-	V8	Urine
83	+	+	+	-	-	-	+	-	-	V8	Blood
84	+	+	+	-	-	-	+	+	-	V1	Urine
85	+	+	+	+	-	-	+	-	-	V8	Blood
86	-	+	+	+	-	-	+	-	-	V8	Sputum
87	+	+	+	-	-	+	+	+	-	V1	Blood
88	-	+	+	-	-	+	+	-	-	V8	Blood
89	+	-	-	+	-	-	+	-	+	V4	Urine
90	+	-	-	+	-	-	+	+	+	V2	Sputum
91	+	-	-	+	-	-	+	+	+	V2	Urine
92	+	+	+	-	-	-	+	-	-	V8	Urine
93	+	+	+	-	-	+	+	-	-	V8	Blood
94	-	+	+	-	-	-	+	-	+	V4	Urine
95	+	-	-	+	-	-	+	+	-	V1	Urine
96	+	+	+	-	+	+	+	+	+	V2	Blood
97	+	+	+	+	-	-	+	+	-	V1	Urine
98	+	+	+	-	-	-	+	+	+	V2	CSF
99	+	+	+	+	-	-	+	+	+	V2	Blood
100	+	+	+	-	-	+	+	-	-	V8	Sputum

AcrAB efflux pump and mrkA biofilm gene expression

The eight MDR (1, 6, 10, 13, 17, 18, 23 and 25 isolates NO.) and non-MDR (30, 37, 38, 46, 89, 90, 91 and 95 isolates NO.) selected K. pneumoniae strains were used for AcrA and mrkA gene expression analysis. The results of Real Time PCR showed that AcrA and mrkA gene were up-regulated significantly in MDR isolates comparing to non-MDR isolates. There was a significant relationship between MDR isolates, AcrA and mrkA gene expression (P<0.05) (Figure 2).

Rep-PCR typing

According to the dendrogram, Repetitive element sequence-based PCR (rep-PCR) revealed 11distinct patterns of K. pneumoniae isolates (Figure 3). The 11 rep genotypes were designed rep1 to rep11. The rep type 4-7 were the most common and, followed by type rep 1, 9 and 3, which consisted non-MDR isolates (Group I: 30, 95, 90, 91, Group C: 37, 89, Group J: 38 and 46 isolates NO). The rep 5 type was unique and each contained one strain exclusively. Based on statistical correlation tests, the rep 2, 4, 5, 6 and 7 significantly correlates with MDR strains and virulence patterns (P<0.05). The strains showed high similarity which may suggest that those isolates consist a clonal lineage (P<0.05).

Multidrug-resistant (MDR) K. pneumoniae strains are an important cause of several life-treating infections, worldwide [32]. The extensive use of antimicrobial agents led to a high prevalence of MDR K. pneumoniae strains [33]. The increasing rate of K. pneumoniae strains resistant to multiple antimicrobials is a global public health problem [34]. In this study, the prevalence of MDR K. pneumoniae isolates was 92%. The high rate of MDR strains was also shown in other studies. Moreover, 48% and 47% of K. pneumoniae strains were resistant to imipenem and meropenem, respectively. From the results, it can be concluded that there has been a significant increase in carbapenem resistant K. pneumoniae isolates in Iran. It seems that the production of carbapenemase and metallobetalactamase have an important role in carbepenems resistance [35]. Our results is supported by some previous reports. Manjula et al, indicted 90.2% of isolates were MDR and the majority of MDR strains were resistant to a high range of antibiotics including penicillin, cephalosporin, fluoroquinolone, aminoglycoside, and sulfonamide [36].

One of the possible reason for high rate of antimicrobial resistance is lack of strict policies for use of antibiotics in Iran. Another mechanism of multidrug resistant is efflux pumps which used by K. pneumoniae strains [37]. The efflux pumps could reduce the intracellular concentration of antibiotics which is as an important cause of bacterial survival [38]. In our study, the AcrAB efflux pump is most common efflux pump in K. pneumoniae strains comparing to mdtk and it was significantly correlated with MDR phenotype. Our results are consistent with other reports which indicated that the multidrug efflux pump system (AcrAB-TolC) in K. pneumoniae strains is responsible for antibiotics especially fluoroquinolones such as ciprofloxacin, tetracycline and beta-lactam antibiotics in MDR isolates.

In addition, 77% of K. pneumoniae strains were biofilm former and 89% of biofilm former were MDR. Until now, it has been shown a significant correlation between MDR phenotype and the biofilm forming ability of K. pneumoniae strains [39]. In addition, the relationship between antibiotic resistance and biofilm formation has also been studied in strains grown under the antibiotic dose especially in sub-minimum inhibitory concentration [40]. There was a significant relationship between strains of K. pneumoniae isolated from urine and biofilm formation. Most of urine originate strains exhibited strong biofilm capacity. In the current study, K. pneumoniae strains isolated from clinical specimens harbored high prevalence of efflux pump, biofilm and virulence associated genes. The virulence associated genes were also dominant in MDR strains. Type 1 fimbriae (fimH-1) and Type 3 fimbrial adhesion (mrkA and mrkD) are the most common bacteria cells adhesive agent which can mediate the binding of K. pneumoniae strains to endothelial and epithelial cells of urinary tracts cause to urinary tract infections [41, 42]. Type 3 fimbrial adhesion plays an important role in the biofilm formation of K. pneumoniae strains, however, their exact role in the biofilm formation remains unclear [43]. The results of Nirwati et al, 2019 study on biofilm formation in K. pneumoniae strains isolated from clinical samples showed that 85.63% of the strains were biofilm and that is more than the results of our study [44]. In our study, the fimH, mrkA and mrkD were detected in all types of urine, blood and CSF isolates especially in urine isolates. The enterobactin biosynthesis gene (entB), serum resistance-associated outer membrane lipoprotein (traT) and regulators of mucoid phenotype A (rmpA) were detected in 80%, 62% and 48% of K. pneumonia strains. The traT gene encodes an outer membrane protein which plays an important role in conjugation and inhibition of complement cascade and act as invasin [45]. Molecular typing of bacteria is a very suitable method for differentiation of microbial pathogens and among the typing methods, rep-PCR technique is widely used for genotyping of bacterial strains. [46]. In our study, out of 100 K. pneumoniae strains, rep-PCR could differentiated into 11 distinct patterns and most MDR strains were put in the same patterns. Our data confirmed the Lai et al results which showed pathogenic K. pneumoniae strains are heterogeneous, because of variation in genome sequences [47]. Our results showed the correlation of MDR strains with rep-PCR patterns. However, the rep-PCR revealed no statistically significant correlation with virulence type. In addition, the rep-PCR results showed that the same rep-type in two studied hospitals indicated that the same clonal distribution of K. pneumoniae in two hospitals. Our findings can help to interpretation of MDR K. pneumoniae outbreaks associated with specific patterns in the future.

In our study, we reported the high prevalence of MDR K. pneumoniae strains with resistance to multiple antimicrobial agents, the ability to formed biofilm and presence of efflux pump, biofilm and virulence associated genes which can be a great barrier to treatment of K. pneumoniae related infections. Moreover, high genetic similarity of MDR strains in hospitals showed clonal dissemination of K. pneumoniae strains that requiring control tools. However, further studies are needed to investigate other epidemiological aspects of the K. pneumoniae strains.

RND: Resistance Nodulation Division

MDR: multidrug-resistant

rep-PCR: Repetitive element sequence-based PCR

CSF: cerebrospinal fluid

MR-VP: (methyl red – Voges Proskauer)

CLSI: Clinical and Laboratory Standards Institute

Availability of data and materials

All quantitative data generated or analysed during this study are included in this published article.

Author information

Molecular Biology Research Center, System Biology and Poisonings Institute, Baqiyatallah University of Medical Sciences, Tehran, Iran

Amir Mirzaie, Reza Ranjbar

Contributions

R. R conceive and designed the experiments. A. A performed the experiments, analyzed the results, done the statistical analyses and wrote the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Reza Ranjbar

Ethics declarations

Ethics approval and consent to participate

Ethics approval for this study was obtained from Baqiyatallah University of Medical Sciences, Tehran, Iran permitted this study with number: IR.BMSU.REC.1397.056. Written informed consent was obtained from all patients participating in this study.

Consent for publication

Not applicable.

Conflict of Interest

The authors declare that there are no conflict of interest.

Funding

This study was supported by the ministry of health and medical education, Tehran, Iran.

Acknowledgments

Research reported in this publication was supported by a grant provided from the ministry of health and medical education, Tehran, Iran.

José A Bengoechea, Joana Sa Pessoa. Klebsiella pneumoniae infection biology: living to counteract host defences. FEMS Microbiol Rev. 2019; 43(2): 123–144.
Ranjbar R, Fatahian Kelishadrokhi A, Chehelgerdi M. Molecular characterization, serotypes and phenotypic and genotypic evaluation of antibiotic resistance of the Klebsiella pneumoniae strains isolated from different types of hospital-acquired infections. Infect Drug Resist. 2019; 12: 603–611.
Kelly L. Wyres, Ryan R. Wick, Louise M. Judd, Roni Froumine, Alex Tokolyi, Claire L. Gorrie, Margaret M. C. Lam, Sebastián Duchêne, Adam Jenney, Kathryn E. Holt. Distinct evolutionary dynamics of horizontal gene transfer in drug resistant and virulent clones of Klebsiella pneumoniae. PLoS Genet. 2019; 15(4): e1008114.
Ciccozzi M, Cella E, Lai A, De Florio L, Antonelli F, Fogolari M, Maria Di Matteo F, Pizzicannella M, Colombo B, Dicuonzo G, Angeletti S. Phylogenetic analysis of multi-drug resistant Klebsiella pneumoniae strains from Duodenoscope biofilm: microbiological surveillance and reprocessing improvements for infection prevention. Front Public Health. 2019; 7: 219. Published online 2019. doi: 10.3389/fpubh.2019.00219
Fuzi M, Baño JR, Toth A. Global Evolution of Pathogenic Bacteria With Extensive Use of Fluoroquinolone Agents. Front Microbiol. 2020; 11: 271. Published online 2020. doi: 10.3389/fmicb.2020.00271
Wanjiang Z, Yao Z, Changzhen W, Wenyu L, Ruichao L, Fuguang C, Tian L, Yanhe Zh, Stefan S, Siguo L. Characterization of a multidrug-resistant porcine Klebsiella pneumoniae sequence type 11 strain coharboring bla_KPC-2 and fosA3 on two novel hybrid plasmids. mSphere. 2019; 4(5): e00590-19.
Yoon EJ, Oh Y, Jeong SH. Development of tigecycline resistance in carbapenemase-producing Klebsiella pneumoniae sequence type 147 via AcrAB overproduction mediated by replacement of the ramA promoter. Ann Lab Med. 2020; 40(1):15-20.
Xu Q, Jiang J, Zhu Z, Xu T, Sheng ZK, Ye M, Xu X, Wang M. Efflux pumps AcrAB and OqxAB contribute to nitrofurantoin resistance in an uropathogenic Klebsiella pneumoniae Int J Antimicrob Agents. 2019;54(2):223-227.
Naha S, Sands K, Mukherjee S, Roy C, Rameez MJ, Saha B, Dutta S, Walsh TR, Basu S. KPC-2-producing Klebsiella pneumoniae ST147 in a neonatal unit: Clonal isolates with differences in colistin susceptibility attributed to AcrAB-TolC pump. Int J Antimicrob Agents. 2020; 55(3):105903.
Yoon EJ, Oh Y, Jeong SH. Development of tigecycline resistance in carbapenemase-producing Klebsiella pneumoniae sequence type 147 via AcrAB overproduction mediated by replacement of the ramA promoter. Ann Lab Med. 2020;40(1):15-20.
Grimsey EM, Fais C, Marshall RL, Ricci V, Ciusa ML, Stone JW, Ivens A, Malloci G, Ruggerone P, Vargiu AV, Piddock LJV. Chlorpromazine and amitriptyline are substrates and inhibitors of the AcrB multidrug efflux pump. 2020;11(3):e00465-20.
Shao L, Yao B, Yang J, Li X, Ye K, Zhang Y, Wang C. Characterization of a multidrug-resistant Klebsiella pneumoniae ST3330 clone responsible for a nosocomial outbreak in a neonatal intensive care unit. Ann Palliat Med. 2020; 9(3):1092-1102.
Sahoo RK, Das A, Gaur M, Pattanayak A, Sahoo S, Debata NK, Rahman PKSM, Subudhi E. Genotypic validation of extended-spectrum β-lactamase and virulence factors in multidrug resistance Klebsiella pneumoniae in an Indian hospital. Pathog Glob Health. 2019; 113(7):315-321.
Marques C, Belas A, Aboim C, Cavaco-Silva P, Trigueiro G, Gama LT, Pomba C. Evidence of sharing of Klebsiella pneumoniae strains between healthy companion animals and cohabiting humans. J Clin Microbiol. 2019; 57(6):e01537-18.
Tang M, Wei X, Wan X, Ding Z, Ding Y, Liu The role and relationship with efflux pump of biofilm formation in Klebsiella Pneumoniae. Microb Pathog. 2020;147:104244.
Vuotto C, Longo F, Pascolini C, Donelli G, Balice MP, Libori MF, Tiracchia V, Salvia A, Varaldo PE. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol. 2017; 123(4):1003-1018.
Subramanian P, Shanmugam N, Sivaraman U, Kumar S, Selvaraj S. Antiobiotic resistance pattern of biofilm-forming uropathogens isolated from catheterized patients in Pondicherry, India. Australas Med J. 2012; 5: 344–348.
Highsmith AK, Jarvis WR. Klebsiella pneumoniae: selected virulence factors that contribute to pathogenicity. Infect Control. 1985; 6(2):75-7.
Ghalavand Z, Heidary Rouchi A, Bahraminasab H, Ravanasa E, Mirsamadi ES, Nodeh Farahani N, Nikmanesh B. Molecular testing of Klebsiella pneumoniae contaminating tissue allografts recovered from deceased donors. Cell Tissue Bank. 2018;19(3):391-398.
Mukherjee S, Bhattacharjee A, Naha S, Majumdar T, Debbarma SK, Kaur H, Dutta S, Basu S. Molecular characterization of NDM-1-producing Klebsiella pneumoniae ST29, ST347, ST1224, and ST2558 causing sepsis in neonates in a tertiary care hospital of North-East India. Infect Genet Evol. 2019; 69:166-175.
Collee J. In Mackie & Mccartney Practical Medical Microbiology(ed Collee J. G., Fraser A. G., Marimon B. P., Simmons A.) (Elsevier, 2007).
(Clinical and Laboratory Standards Institute, PA, USA, 2020).
Behdad R, Pargol M, Mirzaie A, Karizi SZ, Noorbazargan H, Akbarzadeh I. Efflux pump inhibitory activity of biologically synthesized silver nanoparticles against multidrug-resistant Acinetobacter baumannii clinical isolates. J Basic Microbiol. 2020; 60(6):494-507.
Hasan ME, Shahriar A, Shams F, Nath AK, Emran TB. Correlation between biofilm formation and antimicrobial susceptibility pattern toward extended spectrum β-lactamase (ESBL)- and non-ESBL-producing uropathogenic bacteria. J Basic Clin Physiol Pharmacol. 2020 Jan 13:/j/jbcpp.ahead-of-print/jbcpp-2019-0296/jbcpp-2019-0296.xml. doi: 10.1515/jbcpp-2019-0296.
Alkhudhairy MK, Alshadeedi SMJ, Mahmood SS, Al-Bustan SA, Ghasemian A. Comparison of adhesin genes expression among Klebsiella oxytoca ESBL-non-producers in planktonic and biofilm mode of growth, and imipenem sublethal exposure. Microb Pathog. 2019; 134:103558.
Wasfi R, Elkhatib WF, Ashour HM. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals. Sci Rep. 2016; 6:38929.
SahlyH, Navon-Venezia S, L Roesler, A Hay, Y Carmeli, R Podschun, C Hennequin, C Forestier, I Ofek. Extended-spectrum beta-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella Pneumoniae. Antimicrob Agents Chemother. 2008; 52(9):3029-34.
El Fertas-Aissani R., Messai Y., Alouache S. & Bakour R. Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniaestrains isolated from different clinical specimens. Pathol Biol (Paris) 61, 209–216, doi: 10.1016/j.patbio.2012.10.004 (2013).
Siu L. K. et al. Molecular typing and virulence analysis of serotype K1 Klebsiella pneumoniaestrains isolated from liver abscess patients and stool samples from noninfectious subjects in Hong Kong, Singapore, and Taiwan. Journal of Clinical Microbiology 49, 3761–3765, doi: 10.1128/JCM.00977-11 (2011).
Marroquin S, Brittney Gimza, Brooke Tomlinson, Michelle Stein, Andrew Frey, Rebecca A Keogh, Rachel Zapf, Daniel A Todd, Nadja B Cech, Ronan K Carroll, Lindsey N Shaw. MroQ is a novel Abi-Domain protein that influences virulence gene expression in Staphylococcus aureus via modulation of Agr activity. Infect Immun. 2019; 87(5):e00002-19.
Mohamed M. Hassan & El-Sayed B. Belal. Antibiotic resistance and virulence genes in enterococcus strains isolated from different hospitals in Saudi Arabia. 2016; 30:4, 726-732.
Petrosillo N, Taglietti F, Granata G. Treatment options for Colistin resistant Klebsiella pneumoniae: Present and Future. J Clin Med. 2019; 8(7):934.
Ciccozzi M, Cella E, Lai A, De Florio L, Antonelli F, Fogolari M, Di Matteo FM, Pizzicannella M, Colombo B, Dicuonzo G, Angeletti S. Phylogenetic analysis of multi-drug resistant Klebsiella pneumoniae strains From duodenoscope biofilm: microbiological surveillance and reprocessing improvements for infection prevention. Front Public Health. 2019; 7:219.
Khandelwal V, Sharma S. Fatal MDR Klebsiella in ICU - How was it Dealt with? Indian J Crit Care Med. 2019; 23(9):411-413.
Durante-Mangoni E, Andini R, Zampino R. Management of carbapenem-resistant Enterobacteriaceae infections. Clin Microbiol Infect. 2019; 25(8):943-950.
GM N, CM G. Nagshetty K, Patil SA, Gaddad SM, Shivannavar CT: antibiotic susceptibility pattern of ESbetaL producing Klebsiella pneumoniae isolated from urine samples of pregnant women in Karnataka. J Clin Diagn Res. 2014;8(10):DC08–DC11.
Maurya N, Jangra M, Tambat R, Nandanwar H. Alliance of efflux pumps with β-lactamases in multidrug-resistant Klebsiella pneumoniae Microb Drug Resist. 2019; 25(8):1155-1163.
Xu Q, Jiang J, Zhu Z, Xu T, Sheng ZK, Ye M, Xu X, Wang M. Efflux pumps AcrAB and OqxAB contribute to nitrofurantoin resistance in an uropathogenic Klebsiella pneumoniae Int J Antimicrob Agents. 2019; 54(2):223-227.
Ostria-Hernandez ML, Juárez-de la Rosa KC, Arzate-Barbosa P, Lara-Hernández A, Sakai F, Ibarra JA, Castro-Escarpulli G, Vidal JE. Nosocomial, Multidrug-Resistant Klebsiella pneumoniae Strains Isolated from Mexico City Produce Robust Biofilms on Abiotic Surfaces but Not on Human Lung Cells. Microb Drug Resist. 2018; 24(4):422-433.
Maharjan G, Khadka P, Siddhi Shilpakar G, Chapagain G, Dhungana GR. Catheter-Associated Urinary Tract Infection and Obstinate Biofilm Producers. Can J Infect Dis Med Microbiol. 2018; 2018:7624857.
Marques C, Menezes J, Belas A, Aboim C, Cavaco-Silva P, Trigueiro G, Telo Gama L, Pomba C. Klebsiella pneumoniae causing urinary tract infections in companion animals and humans: population structure, antimicrobial resistance and virulence genes. J Antimicrob Chemother. 2019; 74(3):594-602.
Panjaitan NSD, Horng YT, Cheng SW, Chung WT, Soo PC. EtcABC, a Putative EII complex, regulates type 3 fimbriae via CRP-cAMP signaling in Klebsiella pneumoniae. Front Microbiol. 2019;10:1558.
Khalil MAF, Hager R, Abd-El Reheem F, Mahmoud EE, Samir T, Moawad SS, Hefzy EM. A Study of the Virulence Traits of Carbapenem-Resistant Klebsiella pneumoniae Isolates in a Galleria mellonella Model. Microb Drug Resist. 2019; 25(7):1063-1071.
Nirwati H, Kian Sinanjung, Fahrina Fahrunissa, Fernando Wijaya, Sarastia Napitupulu, Vania P Hati, Mohamad S Hakim, Andreanita Meliala, Abu T Aman, Titik Nuryastuti. Biofilm Formation and Antibiotic Resistance of Klebsiella pneumoniae Isolated From Clinical Samples in a Tertiary Care Hospital, Klaten, Indonesia. BMC Proc. 2019;13(Suppl 11):20. doi: 10.1186/s12919-019-0176-7.
Kuş H, Arslan U, Türk Dağı H, Fındık D. Investigation of various virulence factors of Klebsiella pneumoniae strains isolated from nosocomial infections. Mikrobiyol Bul. 2017; 51(4):329-339.
Rojas LJ, Salim M, Cober E, Richter SS, Perez F, Salata RA, Kalayjian RC, Watkins RR, Marshall S, Rudin SD, Domitrovic TN, Hujer AM, Hujer KM, Doi Y, Kaye KS, Evans S, Fowler VG Jr, Bonomo RA, van Duin D. Colistin Resistance in Carbapenem-Resistant Klebsiella pneumoniae: Laboratory Detection and Impact on Mortality. Clin Infect Dis. 2017; 64(6):711-718.
Lai Y. C., Yang S. L., Peng H. L. & Chang H. Y. Identification of genes present specifically in a virulent strain of Klebsiella pneumoniae. Infect Immun68, 7149–7151 (2000).