Phenotyping and Validation of Molecular Markers Associated With Rust Resistance Genes in Wheat Cultivars in Egypt

doi:10.21203/rs.3.rs-976250/v1

Download PDF

Research Article

Phenotyping and Validation of Molecular Markers Associated With Rust Resistance Genes in Wheat Cultivars in Egypt

https://doi.org/10.21203/rs.3.rs-976250/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Nov, 2021

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Thirteen Egyptian wheat cultivars were evaluated and characterized for adult plant resistance (APR) to yellow, leaf, and stem rusts. Markers linked to yellow, leaf and stem rust resistance genes were validated and subsequently used to identify wheat cultivars containing more than one rust resistance gene. Results of the molecular marker detection indicated that several genes, either alone or in different combinations, were present among the wheat cultivars, including Yr, Yr78 (stripe rust), Lr, Lr70 (leaf rust), Sr. Sr33, SrTA10187, Sr13, and Sr35 (stem rust), and Lr34/Yr18 and Lr49/Yr29 (leaf/stripe rust). The cultivar Sakha-95 was resistant to leaf and stem rusts, and partially resistant to stripe rust; however, this cultivar contained additional rust resistance genes (Lr, Sr and Lr/Yr). The area under the disease progress curve (AUDPC) type for the various wheat cultivars differed depending on the type of rust infection (yellow, leaf, or stem rust, indicated by Yr, Lr, and Sr). The cultivars Gem-12, Sids-14, Giza-171, and Giza-168 had AUDPC types of partial resistance (PR) and resistance (R). All six cultivars, however, contained additional rust resistance genes.

Molecular Biology

Molecular Genetics

rust

wheat cultivars

resistance genes

validation

SSR markers

Wheat yellow rust, also known as yellow rust, is caused by Puccinia striiformis Westend f. sp. tritici. It occurs at high altitudes in temperate zones worldwide [1]. Yield losses from yellow rust can be considerable, ranging from 40% loss to complete destruction of the crop, depending upon the growth stage at which the disease attacks [2]. Planting a crop with diverse genetics is the most economical and environmentally safe method for controlling this disease.

Leaf rust, caused by Puccinia triticina, is one of the most common diseases of wheat, occurring nearly everywhere wheat is grown [3]. In Egypt, wheat cultivars lacking adequate resistance to leaf rust can suffer yield losses of 5-10% or more [4]. Wheat stem rust, caused by Puccinia graminis Pers. f. sp. tritici (Eriks. & E. Henn.), is still the biggest biotic threat to Egyptian wheat production. Wheat stem rust affects the entire wheat crop, especially during the late spring. Infection results in blockage of the vascular system, which leads to stunting and lodging of weak stalks, eventually causing severe yield losses as high as 100% due to shriveled grain and damaged tillers [5]. In Egypt, yield losses from stem rust ranged from 1.96–8.21% on Egyptian wheat cultivars [6].

Recurring wheat rust diseases cause considerable yield losses worldwide. To prevent yield loss, different fungicides are used, either alone or in combination, to respond to increased disease aggressiveness under field conditions. During the growing seasons of 2018/2019 and 2019/2020 in Egypt, the spread of yellow rust in wheat led to the consumption of many fungicides to combat widespread crop disease [7]. Adult plant resistance (APR) has often been considered a type of polygenic resistance [8]. This form of resistance protects wheat cultivars against yellow, leaf, and stem rust races by pyramiding many resistance genes in a single variety, thereby conferring a high level of generalized resistance against the target pathogen race. In this respect, [9]stated that breeding programs should develop and release rust resistant cultivars, conditioning them with both race-specific and race-nonspecific resistance genes. The identification of genes conferring APR to wheat stem rust would be an initial and significant step towards effectively controlling this disease.

The best approach in preventing yield loss from wheat rusts is to follow a durable disease resistance program in commercially adopted cultivars that have otherwise good agronomic traits, but are susceptible to disease. Using resistant cultivars is the cheapest, most reliable, and most environmentally friendly way to control rust disease. The primary focus of any disease resistance breeding program is to work on achieving durable resistance, which often involves identifying the race-nonspecific or slow-rusting yellow, leaf, and stem rust resistance genes with molecular markers [10].

Marker-assisted selection (MAS) has been broadly used; however, breeding methods for MAS depend on both phenotypic and genotypic selection. In wheat, MAS may be achieved using a robust DNA molecular marker firmly associated with the resistance genes Lr, Yr, and Sr [11]. Closely linked markers give phenotype-unbiased choices of the linked genes in the cultivars. Such molecular markers confirm the identification of marked genes with close genetic similarity to the cultivar in question.

Yellow rust, a destructive disease of wheat, causes significant yield loss [12, 13, 14]. Validation and characterization of wheat genotypes for the yellow rust resistance gene Yr78 has been attempted using DNA bulked segregant analysis (BSA), resistance gene analog polymorphism (RGAP), and simple sequence repeat (SSR) techniques [14]. Molecular markers linked to the resistance gene Yrwh2 have been identified, making these markers potentially useful for improving yellow rust resistance in wheat cultivars when used in integration with other genes [15]. The validation of a polymorphic fragment linked to Yr10 was tested using the marker RAPD OPE5. The resulting 1100_bp fragment was found in all fourteen resistant BC4F5 lines, and was absent in all susceptible lines tested [16]. The markers gwm389 and BS00062676 flanked Yr57 and were genotyped on a set of Indian and Australian wheat cultivars. Cultivars known to lack Yr57 showed an absence of resistance-linked alleles from these markers. These markers would be useful in marker-assisted pyramiding of Yr57 with other marker-tagged major and minor genes [17]. Haplotype analysis identified specific SNPs linked to Yr26 and advanced robust and breeder-friendly KASP markers. This integration strategy can be applied to speed-generate many markers that are closely linked to target genes [18]. The development, validation, and re-selection of wheat genotypes with the pyramided genes Yr64 and Yr15 are linked to increased yellow rust resistance. These genotypes, with two effectively high genes, should be more helpful than individual gene genotypes in the development of high-level, durably resistant wheat genotypes [19]. The SSR markers Xgwm533, wmc580, cfa2123, and barc71, which are linked to the stem rust resistance genes Sr2, Sr13, Sr22, and Sr24, are useful in the MAS of stem rust resistance genes in Egypt [20]. The molecular markers barc8 and gwm11, linked to Yr15, were used for foreground selection and selection of the advanced genotypes WBM3682 and WBM3684 [21].

The SSR markers barc71 and xucw108 were linked to the rust resistance genes Lr24/Sr24 and Lr37/Sr38/Yr17, respectively [22]. In backcrossed plants, rust resistance was transferred from FLW20, and the SCAR marker SCS265512 was used to validate the outcomes of Lr19 in a host-pathogen interaction (HPI) test. Molecular marker-assisted validation for Lr19 showed 88-93% consistency, indicating that both of these techniques must be mutually exclusive for accurate and effective selection of Lr19 [23]. [24] examined five SNP markers linked to Lr48 (IWB31002, IWB39832, IWB34324, IWB72894, and IWB36920) and KASP markers on wheat lines. The SCAR marker SCS1302 for Lr24/Sr24 was used to select plants carrying the respective gene(s). The findings of this investigation proved the usefulness and importance of MAS in precise introgression of genes conferring leaf rust resistance. The validation of the leaf rust resistance gene LrLC10 (Lr13) and its co-segregation markers in wheat genotypes was reported by [25].

In the last few years, new wheat rust races (warrior races) have been found to be more aggressive and tolerant of high temperatures than previously seen. In Egypt, the appearance of new yellow rust races resulted in lost resistance in several of the most resistant cultivars, such as Gemmeiza 11 and Sids 12, and most other Egyptian wheat cultivars. Moreover, the lack of genetic diversity among Egyptian wheat cultivars is a serious problem that could increase the virulence of yellow rust, potentially causing a huge reduction in Egyptian wheat production [26, 27]. Therefore, the aims of this study were (1) to more accurately evaluate and characterize the APR of thirteen Egyptian bread wheat cultivars to yellow, leaf, and stem rust under both artificial inoculation conditions and natural infection conditions in the field; (2) to identify effective genes for controlling yellow, leaf, and stem rust diseases in the tested wheat cultivars using SSR markers; and (3) to identify wheat cultivars containing more than one rust resistance gene.

Thirteen cultivars of spring wheat cultivated in Egypt have been used, and they are described in (Table 1). These cultivars were obtained from Wheat Research Section, Field Crops Research Institute (FCRI), Agricultural Research Center (ARC), Ministry of Agriculture, Egypt. Furthermore, any field activities were conducted properly within the Egyptian laws and regulations by an Agriculture research center (ARC) specialist (Second author on this paper). Therefore, no specific permissions were required for locations or field activities. Furthermore, we confirm that the field studies conducted in the current study did not involve endangering indigenous or protected species.. Each cultivar was planted in 2m long rows with four replicates using a randomized complete block design (RCBD). Recommended agricultural wheat practices were applied. The plots were surrounded by a spreader area planted with a mixture of highly susceptible wheat varieties, including Triticum spelta sahariensis, Morocco, Thatcher, and Max, to spread stem rust inoculum and increase the disease pressure. For field inoculation with yellow, leaf, and stem rust, the spreader plants were misted with water and then dusted with a mixture of uredinio spores of the most prevalent rust races, mixed with talcum powder at a rate of 1 (spores): 20 (talcum powder). All wheat plants were inoculated at the booting stage, according to the method of [28].

Table 1

Name, pedigree, and year of release of thirteen wheat genotypes used in this study
Genotypes	Pedigree	Year of Release
Gemmeiza 9 (Gm-9)	Ald"S"/Huas//CMH74A.630/SxCGM4583-5GM-1GM-0GM.	1999
Gemmeiza 10 (Gm-10)	MAYA74"S"/0N//160-147/3/BB/GLL/4/CHAT"S"/5/CROW"S". GM5820-3GM-1GM-2GM-0GM.	2004
Gemmeiza 11 (Gm-11)	BOW"S"/KVZ"S"//7C/SER182/3/GIZA168/SAKHA61GM5820-3GM-1GM-2GM-0GM	2011
Gemmeiza 12 (Gm-12)	OTUS/3/SARA/THB//VEECMSS97Y00227S-5Y-010M-010Y-010M-2Y-1M-0Y-0GM	2011
Sids-1	HD2172/Pavon "S"//1158.57/Maya74 "S" SD46-4Sd-2SD-1SD-0SD	1996
Sids-12	BUC//7C/ALD/5/MAYA74/ON//1160.147/3/BB/GLL/4/CHAT"S"/6/MAYA/VUL//CMH74A.630/4*SXSD7096-4SD-1SD-1SD-0SD	2007
Sids-13	AMAZ19=KAUZ"S"//TSI/SNB"S". ICW94-0375-4AP-2AP-030AP-0APS-3AP-0APS-050AP-0AP-0SD.	2010
Sids-14	KAUZ"S"//TSI/SNB"S". ICW94-0375-4AP-2AP-030AP-0APS-3AP.	2014
Giza-168	MRL/BUC//SERI.CM93046-8M-0Y-0M-2Y-0B-0GZ.	1999
Giza-171	SAKHA 93 / GEMMEIZA 9S.6-1GZ-4GZ-1GZ-2GZ-0S	2013
Misr -1	OASIS/SKAUZ//4BCN1312PASTOR.CMSSOOYO1881T-050M-030Y-030M-030WGY-33M-0Y-0S.	2011
Misr -2	SKAUZ/BAV92. CMSS96M03611S-1M-010SY010M-010SY-8M-0Y-0S.	2011
Sakha-95	POSTOR//SITE/MO/3/CHEN/AEGILOPS/SQUARROSA(TAUS)	2018

Disease assessment

Disease assessment was performed over two seasons of the study when the susceptible wheat varieties expressed 50% rust severity. The percentage rust severity was recorded separately for yellow, leaf, and stem rusts based on a modified Cobb’s scale of 0-100% [29]. The host response assessment also included recording the infection type (IT), according to [30]: Tr = trace, R = resistant, MR = moderately resistant, R-MR = resistant to moderately resistant, MR-MS (also abbreviated as M) = moderately resistant to moderately susceptible, MS-S = moderately susceptible to susceptible, MS = moderately susceptible, and S = susceptible. The final disease severity score was obtained for each individual by multiplying the individual’s IT assessment by its numerical value, where Tr = 0.1; R = 0.2; MR = 0.4; M = 0.6; MS = 0.8; and S = 1.0; each genotype’s scores were then averaged to give the average coefficient of infection (ACI) [30]. Disease severity scores were used to estimate the area under the disease progress curve (AUDPC), which was calculated for each genotype according to an equation proposed by [31], as follows:

AUDPC = D [1/2 (Y1 + YK) + Y2 + Y3 +…. Y (K-1)]

Where:

D = Time interval (days between consecutive records);

Y1 + YK = Sum of the first and final disease scores;

Y2 + Y3 + …. + Y (K-1) = Sum of all in-between disease scores.

The rate of rust disease increase (r-value) was also estimated as a function of time, according to the formula by [32]:

r-value =

Where:

X₁ = the proportion of susceptible infected tissue (disease severity) at date t₁;

X₂ = the proportion of susceptible infected tissue (disease severity) at date t₂;

t₂ - t₁ = the interval in days between the dates t₁ and t₂.

Statistical analysis

Combined analysis of variance (ANOVA) over the two seasons was carried out to determine significance differences among cultivars (Table 2), as outlined by [33]. Mean comparisons for variables were made among genotypes using least significant difference (LSD) tests at α = 0.05.

DNA extraction and SSR analysis

Young leaves from each cultivar were removed and frozen (0.5 g; derived from the shoot tips), then ground to a powder in a mortar with liquid nitrogen. The genomic DNA of each cultivar was extracted using a Wizard Genomic DNA Purification Kit (PROMEGA Corporation Biotechnology, Madison, Wisconsin, USA). After extraction, the samples were treated with RNase and maintained at a temperature of −20°C. The DNA quality was checked by electrophoresis on 0.8% agarose gel, and DNA concentration was determined using an Epoch multi-volume spectrophotometer (Thermo Scientific, USA). The quantified DNA stock was diluted to a final concentration of 25 ng µl⁻¹. Twenty-one SSR markers linked to rust resistance genes in wheat were used (Table 2). Several studies have previously reported linkage of these microsatellite primers with rust resistance genes [34,35,36; 37,38, 39, 40, 14, 18, 41, 42, 43, 44, 45,36]. The polymerase chain reaction (PCR) mixture consisted of 20–50 ng of genomic DNA, 1 × PCR buffer, 1.5 mM MgCl₂, 0.1 mM dNTP, 0.5 µM primer, and 1 U Taq polymerase, in a volume of 0.025 cm³. The PCR program for SSR analysis consisted of an initial denaturation at 94°C for 3 min, followed by 40 cycles of denaturation at 94°C for 1 min, annealing at 50°C–61°C (depending on the individual SSR primers) for 1 min, extension at 72°C for 2 min, and final extension at 72°C for 10 min. The amplification products were electrophoretically resolved on 3% (m/v) agarose gels containing 0.1 µg cm⁻³ ethidium bromide, and photographed on a UV trans-illuminator.

Table 2

SSR primers, sequences, annealing temperature, expected amplicon size, and linked resistance gene(s) used for detecting variation in 13 wheat cultivars
Marker	Sequences	Annealing temperature	Expected ^a size (bp)	Linked resistant gene(s)
Barc64-7A	GCGGAGTCTGCAATTAGTATAGGTAT GCATCCACCTCCGCAGTCAGT	55	269	Lr
Barc104-6A	GCGCTTCCAAGGCTTAGAGGCT GCGAGCATCAATAATTGAGAAATACATAGA	50	177	Sr13
Barc130-5D	CGGCTAGTAGTTGGAGTGTTGG ACCGCCTCTAGTTATTGCTCTC	52	225	Lr70
Barc1473B	GCGCCATTTATTCATGTTCCTCAT CCGCTTCACATGCAATCCGTTGAT	52	105	Yr?
Barc152-1B	CTTCCTAAAATCGGGCAACCGCTTGTTG GCGTAATGATGGGAGTGGCTATAGGGCAGTT	50	145	Sr33
Barc167-2B	AAAGGCCCATCAACATGCAAGTACC CGCAGTATTCTTAGTCCCTCAT	50	255	Lr
Barc173-6D	GGGGATCCTTCAACAATAACA GCGAGATGGCATTTTTAAATAAAGAGAC	50	237	SrTA10187
Barc180-3B	GCGATGCTTGTTTGTTACTTCTC 3' 5' GCGATGGAACTTCTTTTTGCTCTA	52	194	Yr78
Barc181-1B	CGCTGGAGGGGGTAAGTCATCAC 3' CGCAAATCAAGAACACGGGAGAAAGAA	58	185	Yr26
Barc182-7B	CCATGGCCAACAGCTCAAGGTCTC CGCAAAACCGCATCAGGGAAGCACCAAT	58	105	Lr
Barc183-2B	CCCGGGACCACCAGTAAGT GGATGGGGAATTGGAGATACAGAG	58	179	Sr42
Barc198--6B	CGCTGAAAAGAAGTGCCGCATTATGA CGCTGCCTTTTCTGGATTGCTTGTCA	50	145	Yr78
Barc200-2B	GCGATATGATTTGGAGCTGATTG GCGATGACGTTAGATGCGGAATTGT	52	168	Sr Yanac
Barc352-4D	CCCTTTCTCGCTCGCCTATCCC CTGTTTCGCCCAATCTCGGTGTG	63	249	Lr34/Yr18
Wmc27-2B	AATAGAAACAGGTCACCATCCG TAGAGCTGGAGTAGGGCCAAAG	61	389	Sr P14666
Wmc44-1B	GGTCTTCTGGGCTTTGATCCTG TGTTGCTAGGGACCCGTAGTGG	61	242	Lr49/Yr29
Wmc166-2D	ATAAAGCTGTCTCTTTAGTTCG GTTTTAACACATATGCATACCT	15	305	Yr18
Wmc169-3A	TACCCGAATCTGGAAAATCAAT TGGAAGCTTGCTAACTTTGGAG	61	167	Sr35
wmc175-3A	GCTCAGTCAAACCGCTACTTCT CACTACTCCAATCTATCGCCGT	61	253	Sr9/Yr5
Wmc219-4A	TGCTAGTTTGTCATCCGGGCGA CAATCCCGTTCTACAAGTTCCA	61	204	Sr ND6-43/Sr60
Wmc233-5D	GACGTCAAGAATCTTCGTCGGA ATCTGCTGAGCAGATCGTGGTT	61	260	Lr70
^a Expected size (bp) on Chinese Spring.

Data handling

The SSR data was scored based on the presence or absence of amplified products for each primer, after excluding the unreproducible bands. Products found to be present in a given wheat cultivar were designated as “+” and products found to be absent were designated as “−”.

The thirteen wheat cultivars differed significantly in their responses to yellow, leaf, and stem rust disease, as shown by the phenotypic expression of disease parameters during the 2019/2020 growing season (Table 3 and Supplementary TableS1).

The wheat cultivars Gem-12, Sids-14, Giza-171, and Sakha-95 displayed high APR to yellow rust, showing ITs of MR or MS. These cultivars also showed the lowest values of final rust severity (FRS), AUDPC, and r-value. Conversely, Giza-168 had a low IT, r-value, and AUDPC, which indicates that this cultivar had partial resistance to yellow rust. The remaining eight cultivars showed the lowest levels of field resistance to yellow rust infection; these had the highest recorded FRS, as well as relatively high AUDPC and high r-values (Table 3 and Supplementary Table S1).

The wheat cultivars Gem-12, Sids-14, Giza-171, Misr-1, and Sakha-95 had partial resistance to leaf rust (IT of MR to MS), AUDPC of less than 150, and the lowest r-values. The other wheat cultivars presented as susceptible to leaf rust symptoms, with reactions of 10 S to 80 S, AUDPC greater than 170, and the highest r-values (Table 3 and Supplementary Table S1).

Stem rust disease severity could be ranked into three main groups. The first group included the seven wheat cultivars Gem-12, Sids-1, Sakha-95, Gemmeiza-11, Sids-13, Giza-168, and Giza-171 (resistant cultivars), which exhibited the highest levels of resistance or partial resistance. This group had the lowest AUDPC estimates (less than 300.00), and were designated as partially resistant and slow-rusting cultivars. However, this group displayed the highest level of APR and field resistance to stem rust infection throughout the study, indicating that these cultivars may have durable resistance to stem rust. The second group included three wheat cultivars (Gem-9, Gem-10, and Sids-12), which showed intermediate stem rust resistance. These cultivars had FRS values of 20 S, 10 S, and 20 S, respectively, with intermediate AUDPC values and low r-values. This group had the lowest levels of APR to stem rust infection under field conditions. The third group included the wheat cultivars Misr-1 and Misr-2, which showed high FRS of 70 S and 60 S, respectively. These two cultivars had the highest AUDPC and highest r-values, and could therefore be classified as highly susceptible or fast-rusting cultivars (Table 3 and Supplementary Table S1).

Table 3

Final rust severity (FRS), area under disease progress curve (AUDPC), and rate of rust disease increase (r-value) of yellow, leaf, and stem rust evaluated for thirteen Egyptian wheat cultivars grown under field conditions at Sids Research Station during the 2019/2020 growing season
Genotypes	Yellow Rust				Leaf Rust				Stem Rust
	FRS	AUDPC		r-value	FRS	AUDPC		r-value	FRS	AUDPC		r-value
	FRS	Value	Type*	r-value	FRS	Value	Type	r-value	FRS	Value	Type	r-value
Gem-9	50 S	423.50	Sus.	0.219	40 S	315.00	Sus	0.200	20 S	178.50	P.R	0.153
Gem-10	50 S	388.50	Sus.	0.219	30 S	175.00	P.R	0.178	10 S	80.50	P.R	0.114
Gem-11	80 S	577.50	Sus.	0.206	20 S	175.00	P.R	0.153	5 MS	28.00	P.R	0.053
Gem-12	20 MS	129.50	P.R	0.147	20 MS	84.00	P.R	0.140	0	0.00	R	0.00
Sids-1	30 S	213.50	P.R	0.178	80 S	650.00	Sus	0.285	Tr MR	24.50	R	0.033
Sids-12	70 S	700.00	Sus.	0.145	30 S	175.00	P.R	0.178	20 S	178.50	P.R	0.153
Sids-13	60 S	388.50	Sus.	0.238	30 S	175.00	P.R	0.178	TrMS	28.00	R	0.053
Sids-14	20 MS	122.50	P.R	0.140	30 MS	126.00	P.R	0.164	TrMR	24.50	R	0.033
Giza-168	10 S	80.50	P.R	0.114	20 S	210.00	P.R	0.178	10 MS	52.50	P.R	0.088
Giza-171	10 MR	52.50	R	0.088	30 MS	140.00	P.R	0.164	5 MS	28.00	P.R	0.053
Misr-1	40 S	437.50	Sus	0.121	20 MS	112.00	PR	0.140	70 S	570.50	Sus	0.160
Misr-2	50 S	472.50	Sus.	0.140	10 S	70.00	P.R	0.114	50 S	353.50	P.R	0.219
Sakha-95	10 MS	59.50	P.R	0.103	Tr MR	17.50	R	0.053	Tr MR	28.00	R	0.053
Mean	-	578	-	0.294	-	346.35	-	0.303	--	134.14	-	0.166
LSD 0.05	1.79				1.85				1.67
*AUDPC type: Susceptible (Sus.) = AUDPC value greater than 300; Partial resistance (PR) = AUDPC value less than 300; Resistance (R) = AUDPC value less than 300 and infection type (IT) of 0, MR, Tr-MR, and Tr-MS.

Validation of resistance genes (yellow, leaf, and stem rust) in wheat cultivars

Simple sequence repeat molecular markers were amplified to validate the resistance genes Yr, Sr, and Lr in all thirteen Egyptian wheat cultivars (Table 4).

Validation of markers linked to yellow rust resistance genes

The SSR marker barc147-3B was linked to the Yr resistance gene. The marker’s bands showed amplification in the range of 115-150_bp. The 150_bp band was present only in Sids-12, which was a susceptible cultivar, whereas the 115_bp band was present in eight cultivars (Gem-9, Gemmeiza-10, Gem-11, Gem-12, Sids-1, Sids-14, Giza-171, and Misr-1). These cultivars had AUDPC types of partial resistance (PR: Gem-12, Sids-1, and Sids-14), resistance (R: Giza 171), and susceptible (Sus: Gem-9, Gem-10, and Gem-11) (Table 4, Fig. 1a). The SSR marker barc180-3B was linked with Yr78. Four genotypes (Gm-12, Sids-1, Sids-13, and Giza-168) showed the presence of Yr78 with a band size of 150_bp. Three of these cultivars had an AUDPC type of PR, whereas Sids 13 was of the type Sus. Nine cultivars (Gm-9, Gm-10, Gm-11, Sids-12, Sids-14, Giza-171, Misr-1, Misr-2, and Sakha-95) did not contain Yr78 (Table 4, Fig. 1b).

Validation of markers linked to leaf rust resistance genes

The marker barc64-7A amplified a 200_bp fragment for the leaf rust resistance gene. This marker was present in eight genotypes (Gm-9, Gm-10, Gm-11, Gm-12,-Sids-13, Sids-14, Giza-171, and Misr-2); all eight of these cultivars were of the AUDPC type PR, except for Gm 9, which was AUDPC type Sus. Eight genotypes indicated the presence of the leaf rust resistance gene with a band size of 200_bp, whereas five genotypes did not contain this gene (Table 4, Fig. 2a). The SSR molecular marker barc130-5D exhibited linkage with the Lr70 leaf rust resistance gene present on chromosomal locus 5D. This marker showed amplified bands of 285_bp, which were present in all thirteen genotypes. Of these, ten were AUDPC type PR (Gm-10, Gm-11, Gm-12, Sids-12, Sids-13, Sids-14, Giza-168, Giza-171, Misr-1, and Misr-2); one AUDPC type R (Sakha-95); and two type Sus. (Gm-9 and Sids-1) (Table 4, Fig. 2b). The marker barc167-2B amplified a 255_bp fragment for leaf rust resistance. This marker was present in three genotypes (Gm-11, Sids-14, and Sakha-95), of which two were AUDPC type PR (Gm-11 and Sids-14), and one was type R (Sakha-95) (Table 4, Fig. 2c).

Validation of markers linked to stem rust resistance genes

The SSR marker barc104-6A was linked to the gene Sr13. This marker had an amplified band size of 250_bp in seven genotypes (Gm-9, Gm-10, Gm-11, Sids-13, Sids-14, Giza-171, and Misr-2), of which five were AUDPC type PR (Gm-9, Gm-10, Gm-11, Giza-171, and Misr-2), and two were type R (Sids-13 and Sids-14). This resistance gene was absent in the genotypes Gm-12, Sids-1, Sids-12, Giza-168, Misr-1, and Sakha-95. The gene Sr13 is the only known gene to be operative against the TTKS complex of P. graminis f. sp. tritici; this includes the TTKSK (Ug99) race and its variants, TTKST and TTTSK (Table 4, Fig. 3a). The PCR-based diagnostic marker barc152-1B was linked to Sr33, which is found on chromosomal locus 1BS. All genotypes indicated the presence of this gene with a band size of 130_bp. Of these, seven were AUDPC type PR (Gm-9, Gm-10, Gm-11, Sids-12, Giza-168, Giza-171, and Misr-2); five were type R (Gm-12, Sids-1, Sids-13, Sids-14, and Sakha-95); and one was Sus. (Misr-1) (Table 4, Fig. 3b). The marker barc173-6D was linked with the stem rust resistance gene SrTA10187, with a band size of 240_bp. This gene was found in ten cultivars (Gm-9, Gm-10, Gm-11, Gm-12, Sids-12, Sids-13, Sids-14, Giza-171, Misr-1, and Misr-2), of which seven were AUDPC type PR (Gm-9, Gm-10, Gm-11, Sids-12, Giza-171, Misr-1, and Misr-2) and three were type R (Gm-12, Sids-13, and Sids-14). This marker was absent in the remaining four cultivars (Sids-1, Giza-168, Giza-171, and Sakha-95) (Table 4, Fig. 3c). The marker barc200-2B was amplified as a 150_bp fragment for the stem rust resistance gene. This marker was present in two genotypes (Giza-171 and Sakha-95), which were AUDPC types PR and R, respectively (Table 4, Fig. 3e). The SSR marker wmc169 was linked with the stem rust resistance gene Sr35. This marker was amplified to a band size of 120_bp and was found to be present in seven cultivars (Sids-1, Sids-12, Sids-13, Sids-14, Gm-168, Misr-2, and Sakha-95), and absent in the remaining six cultivars (Table 4, Fig. 3d).

Validation of markers linked to leaf/yellow rust resistance genes

The SSR marker barc352-4D was linked with the leaf/yellow rust resistance gene Lr34/Yr18. Eight cultivars (Gm-10, Gm-12, Sids-1, Sids-12, Sids-14, Giza-168, Misr-2, and Sakha-95) indicated the presence of these genes with an amplified band size of 255_bp. Of these, four cultivars (Gem-12, Sids-14, Giza-168, and Sakha-95) were AUDPC type PR or R. The remaining five cultivars showed no introgression for these markers (Table 4, Fig. 4a). The SSR marker wmc44-1B, mapped on the long arm of chromosome 1B and linked to the leaf/yellow rust resistance gene Lr49/Yr29, was amplified to a band size of 242_bp. Out of the thirteen cultivars, six were positive for this marker (Gm-9, Gm-10, Gm-11, Sids-1, Sids-13, and Sids-14) and seven were negative (Table 4, Fig. 4b).

Validation of markers linked to stem/yellow rust resistance genes

The SSR marker wmc175-3A, mapped on the long arm of chromosome 3A and linked to the stem/yellow rust resistance genes Sr9 and Yr5, was used to identify the presence of Sr9 and Yr5 with an amplified band size of 260_bp. Out of the thirteen cultivars, seven (Gm-9, Gm-10, Sids-12, Sids-14, Giza-168, Giza-171, and Sakha-95) were positive for this marker. Of these, three cultivars (Sids-14, Giza-168, and Sakha-95) were AUDPC type PR, and one (Giza-171) was type R (Table 4, Fig. 4c).

Identification of wheat cultivars containing more than one rust resistance dieses

The results of molecular marker detection indicated that Yr (yellow rust); Lr (leaf rust); Sr (stem rust); and Lr/Yr (leaf/yellow rusts), were present alone or in different gene combinations among the wheat cultivars. The cultivar Sakha-95 was AUDPC type R for leaf and stem rusts, and PR for yellow rust dieses. However, Sakha-95 contained several other rust resistance genes (Lr, Sr and Lr/Yr) (Table 5). The AUDPC types for cultivars Gm-12, Sids-14, Giza-171, and Giza-168 were PR and R (Table 5). The cultivar Sids-1 was recorded as PR, Sus, and R for Yr, Lr, and Sr respectively, whereas Sids-13 had respective AUDPC types of Sus, PR, and R for dieses (Yr, Lr, and Sr) respectively. Seven cultivars (Sakha-95, Gm-12, Sids-14, Giza-171, Giza-168, Sids-1, and Sids-13) contained more than one rust resistance gene (Table 5). The phenotypic responses to infection by different rusts indicated the presence of additional slow-rusting resistance genes.

Table 4

Response of molecular markers for the detection of rust resistance genes (yellow rust, leaf rust, stem rust, leaf/yellow rust, and stem/yellow rust) in thirteen wheat cultivars
Rust type	Marker	Expected Resistance genes	Cultivar													Band Size (bp)
Rust type	Marker	Expected Resistance genes	Gm9	Gm10	Gm11	Gm12	Sids1	Sids12	Sids13	Sids14	Giza168	Giza171	Misr1	Misr2	Sakha95	Band Size (bp)
Yellow rust	Barc147	Yr	+	+	+	+	+			+		+	+			115
Yellow rust	Barc180	Yr78				+	+		+		+					150
Leaf rust	Barc64	Lr	+	+	+	+		-	+	+		+		+		200
	Barc130	Lr70	+	+	+	+	+	+	+	+	+	+	+	+	+	285
	Barc167	Lr			+					+					+	255
Stem rust	Barc104	Sr13	+	+	+				+	+		+		+		230
	Barc152	Sr33	+	+	+	+	+	+	+	+	+	+	+	+	+	130
	Barc173	SrTA10187	+	+	+	+		+	+	+		+	+	+		240
	Barc200	Sr									+				+	160
	Wmc169	Sr35						+	+	+	+			+	+	110
Leaf/yellow rust	Barc352	Lr34/Yr18		+		+	+	+		+	+			+	+	255
Leaf/yellow rust	Wmc44	Lr49/Yr29	+	+	+		+		+	+						215
Stem/yellow rust	Wmc175	Sr9 and Yr5	+	+				+		+	+	+			+	260

Table 5

Slow-rusting resistance genes (Yr, Lr, Sr and *Lr/Yr*) associated with molecular markers, and the corresponding phenotypic AUDPC type of seven wheat cultivars
Cultivar	Yellow rust		Leaf rust		Stem rust		Yellow, Leaf, Stem rust
Cultivar	AUDPC Type	Expected Resistance genes	AUDPC Type	Expected Resistance genes	AUDPC Type	Expected Resistance genes	Expected Resistance genes
Sakha-95	PR	None	R	Lr˜70	R	Sr˜33	Lr˜34/Yr˜18
Gm-12	PR	Yr˜78	PR	Lr˜70	R	Sr˜33, TA10187	Lr˜34/Yr˜18
Sids-14	PR	Yr˜	PR	Lr˜70	R	Sr˜13, 33, TA10187	Lr˜34/Yr˜18, Lr˜49/Yr˜29
Giza-171	R	Yr˜	PR	Lr˜70	PR	Sr˜13, 33, TA10187	None
Giza-168	PR	None	PR	Lr˜70	PR	Sr˜33, TA10187	Lr˜34/Yr˜18
Sids-1	PR	Yr˜78	Sus	Lr˜70	R	Sr˜33	Lr˜34/Yr˜18, Lr˜49/Yr˜29
Sids-13	S	None	PR	Lr˜70	R	Sr˜13, 33, 35, TA10187	Lr˜49/Yr˜29

The levels of field resistance (partial resistance) of wheat cultivars and their durability to yellow, leaf, and stem rust infections, were determined during this study using the three epidemiological parameters FRS, AUDPC, and r-value. The exploitation and deployment of this type of partial resistance comprise a major contribution to the genetic improvement of many crops, including wheat, in rust resistance breeding programs worldwide [46, 47, 7]. To increase wheat production in Egypt, breeding programs must select for both yield and disease resistance components, such as the traits studied in this investigation.

Rust diseases have a negative effect on wheat production, which can be attributed to the fact that the fungus causes extensive damage to the vascular system of the susceptible host plant, limiting the transportation of water and nutrients from the soil to the developing kernel and other organs. This in turn interferes with the translocation of photosynthates, which leads to shriveled grains [6]. Similar findings have been reported by numerous other research groups [48]. In highly susceptible varieties, the endosperm barely forms and the resultant grains are invariably completely shriveled.

The validation and characterization of APR for the yellow rust resistance gene Yr78 was explained by [14]. The SSR markers wmc737 and wmc494, and the SNP marker IWA7257, were used to test the presence of this gene. Expected PCR fragments of 871 and 537_bp were amplified from the positive control line T. turgidum ssp. The gene-based markers owm45F3R3, DArT-STS, and sun104 were genotyped on a set of thirteen Indian and 27 Australian wheat cultivars to screen the obscurity of alleles linked to the resistance gene Yr51, often referred to as negative validation. None of the genotypes tested were found to amplify the 225_bp allele linked to Yr51, indicating the fitness of this marker in MAS of the gene in these backgrounds. Therefore, sun104 can be used for MAS of Yr51 in wheat genotypes lacking the resistance-linked 225_bp allele [49]. The gene YrWh2 is flanked by the SSR markers wmc540-260_bp and Xgwm566-145_bp. Therefore, these two SSR markers can be used to ascertain the presence or absence of YrWh2 [15]. The gene Yr30 is linked with the SSR markers xgwm533 and xgwm493 [50, 15]. The SSR marker gwm389-150_bp and SNP marker BS00062676 flank the YrAW2 and Yr57 genes for yellow rust resistance. Therefore, these two markers can be used to determine the presence or absence of YrAW2 and Yr57 [17]. The gene Yr60 confers moderate resistance to yellow rust in wheat. The marker wmc776 is linked with Yr60, and both of the SSR markers wmc313 and wmc219 were validated for this gene [45].

The SSR markers barc8 and xgwm493 are the nearest markers flanking Yr15. Fragments have an amplified band size of 221_bp with barc8, and 162_bp with Xgwm273 [51]. The yellow rust resistance gene YrJ22 is linked with the SSR marker wmc658 and the SNP marker IWA1348. These flanking markers could successfully identify resistant and susceptible alleles in wheat cultivars, and can be used for selecting YrJ22 in breeding programs [52]. The SNP markers CM1461, CM501, and WRS467 clearly distinguish wheat cultivars that harbor the genes Yr26, Yr24, YrCH42, and YrGn22, indicating that these markers could be used to confirm the presence of Yr26. Moreover, the combination of CM1461, CM501, and WRS467 appears to be the most predictive of Yr26, based on varietal panels [53, 54, 55. 56, 18]. The yellow rust resistance genes Yr64 and Yr15 are linked with the SSR markers barc8, Xgwm413, and Xgwm273. The presence of fifty F₅ lines selected from the cross of (susceptible line AvS) × (resistant line RIL-Yr64/Yr15) signifies the presence of Yr15. Similarly, the SSR marker xgwm413, with an allele band size of 102_bp, indicates the presence of Yr64 [19]. According to [21, 26], the marker xgwm11 amplified a Yr15-specific 215_bp fragment; the same size band was present in all of the genotypes tested, confirming the presence of Yr15. The presence of Yr15 was also validated in selected genotypes using another closely linked marker, barc8. This marker amplified a 221_bp fragment that was present in all of the genotypes [21].

The leaf rust resistance gene Lr70, which has been newly mapped in the common wheat accession KU3198 (36), is linked with the SSR marker barc130. The SSR marker cfd20 is linked with the leaf rust resistance gene Lrk1 [36]. One hundred and sixty-one plants of the backcross (HS240 susceptible parent/FLW20 Lr19) were determined to be resistant following a HPI check; these were validated using the SCAR marker SCS265512, which is linked to Lr19. Of the original 161 plants, 150 were determined to be positive for Lr19 [23]. Molecular APR markers for the leaf rust resistance gene Lr48 in wheat were reported by [57]. Five SNP markers (IWB31002, IWB39832, IWB34324, IWB72894, and IWB36920) were co-segregated with Lr48. The SSR markers sun563 and sun497 were linked with the leaf rust resistance genes Lr48 and Lr13, and the SSR markers Xgwm429 and barc7 were linked with Lr48 [57]. [58] identified leaf rust resistance genes in wheat cultivars produced in Kazakhstan. They reported that the predictable marker pTAG621 fragment associated with Lr1 was detected in twelve out of 22 wheat cultivars tested. The markers F1.2245 and Lr10-6/r2, linked to Lr10, were found in only two wheat cultivars. The marker Gb-F and -R fragments specific to Lr19 were detected only in the cultivar Pallada from Russia [58]. The SSR markers Xgwm512 and cfd36 were found to be putatively associated with the leaf rust resistance gene LrM. The marker Xgwm512 conducted as a dominant marker and amplified an allele of 200_bp in the rust-resistant genotype Ae. markgrafii, whereas cfd36 behaved as a codominant marker and amplified an allele of 124_bp in the rust-resistant genotypes Ae. markgrafii and IL ER9-700. In the susceptible parent AL, cfd36 amplified two alleles of 110 and 192_bp, respectively [59]. The SSR marker wmc221 and GB markers were linked with the leaf rust resistance gene Lr19. These markers were used to select 25 wheat cultivars that were evaluated for leaf rust resistance under natural field infection conditions. The SSR marker wmc221 amplified a product of 200_bp, suggesting that the Lr19 gene was in only two of the 25 wheat cultivars tested. A band of 220_bp was found in the remaining genotypes, indicating the absence of Lr19 [60]. The markers CAUT163 and Lseq22 were linked with the leaf rust resistance gene LrLC10. Thirty-two wheat genotypes were identified by these two markers from the 984 F₂ homozygous susceptible plants, and were further genotyped with ten additional markers [25].

The resistance gene Sr33 is flanked by the SSR markers barc152 and cfd15, whereas the gene Sr45 is flanked by the SSR markers cfd21 and barc229. As a result, these SSR markers may be used to validate the presence of Sr33 and Sr45 [38]. The resistance gene SrTA10171 in the validated population BC2F₁ was identified by the SSR markers wmc827 and barc173 as being polymorphic among resistant and susceptible genotypes. For the SSR marker wmc827, the donor parent, TA10171, had a 132_bp allele, and the susceptible recurrent parent, KS05HW14, had a 146_bp allele. For the SSR marker barc137, the donor parent, TA10171, had a 275_bp allele, and the susceptible recurrent parent, KS05HW14, had a 237_bp allele [40]. The development and validation of molecular markers linked with the stem rust resistance gene Sr13 in durum wheat was described by [35]. The markers dupw167 and AFSr13 were validated on 21 durum wheat cultivars by incorporating smooth MAS of Sr13 in segregating populations. Only the SSR marker gwm427 showed polymorphism, recognizing the presence of Sr13 in ten of the fifteen backcross derivatives carrying Sr13 from their Sr13-lacking recurrent parents [35]. The validation of markers linked to the stem rust resistance gene Sr28, which is effective against the race Ug99, was described by [61]. In [43], the SSR markers wmc332 and DART wPt-7004 were identified as linked to Sr28 based on the amplification of different sized alleles from the resistant and susceptible genotypes. The marker wmc332 amplified alleles of 214_bp from the resistant genotypes and 208_bp or less from the susceptible genotypes, whereas the marker wPt-7004-PCR resulted in two amplicons of sizes 166 and 194_bp, respectively. Preferential amplification of the 194_bp amplicon was linked with the presence of Sr28 [61]. [41], 62] identified SSR markers of the stem rust resistance gene Sr42 for efficient use in MAS and stacking of resistance genes in wheat breeding populations. The SSR marker cfd49 was linked to Sr42, producing an amplified fragment of 202_bp in resistant genotypes [41]. The SSR markers cfd49 and barc183 were found to flank a gene that was assumed to be Sr42 in wheat genotypes [62]. A detected recombination between Fhb1 and Sr2 using molecular markers was reported by [42], [63, 64]. In these studies, UMN10 was a codominant marker (237 and 240_bp), whereas csSr2 was a dominant marker (172_bp) for the wheat genotypes. A closely linked and codominant SSR marker, Xgwm533 (120_bp), was used to track Sr2 in wheat genotypes [63].Markers flanking csLV34–Xgwm295 were linked with the Yr18/Lr34 genes, which confer effectively durable resistance to rust diseases [65, 66] and trace the origins of their rust resistance region to many current wheat cultivars. Using a diagnostic STS marker revealed that Lr34/Yr18 is a significantly slow-rusting gene, conferring high levels of resistance when concerted with other minor genes [67]. [68] identified close linkage of the SSR marker sun180 to the gene Yr47/Lr52. The amplification of a different sun180 amplicon (195_bp) than that linked with Yr4/Lr52 (200_bp) in wheat genotypes explains its robustness for MAS of these genes. Among 34 F₃ wheat lines, 28 were positive for the SSR marker wmc221, indicating the presence of Lr19/Sr25. Out of fourteen chosen F₄ lines from F₃, nine were positive for Lr19/Sr25. The advanced breeding lines viz., WBM3632 (WBM3697), and WBM3635 were also positive for Lr19/Sr25 using the SCAR marker SCS265512 [69]. [70] identified a durable molecular marker for the validation of the stem rust resistance gene Sr45/Lr21 in common wheat. Tightly linked SSR, STS, and AFLP markers were useful in the planning of the Sr45/Lr21 locus. Sequences from an AFLP marker amplified a fragment that was linked with Sr45/Lr21. The STS marker cssu45 provided amplified fragments of 220 and 238_bp in the resistant and susceptible plants, respectively [35]. [24] consolidated the rust resistance genes Lr19/Sr25 and Lr24/Sr24 in wheat through marker-assisted backcross breeding. Amplification using the marker xwmc221 produced the desired allele size of 200_bp, indicating the presence of Lr19/Sr25 in the resistant genotypes, whereas a band of 220_bp indicated the absence of Lr19/Sr25 in the susceptible genotypes. In the case of the marker SCS1302, a band of 609_bp, indicating the presence of Lr24/Sr24, was obtained in the resistant genotypes, whereas no band occurred in the susceptible genotypes [24]. The APR genes express resistance at the post-seedling stages, showing non-supersensitive reactions and slow disease expansion in cultivars carrying these genes. This type of resistance has also been referred to as slow-rusting or partial resistance, and is considered more durable than other types of resistance [71]. Some APR genes confer pleiotropic resistance to various diseases, including yellow rust, leaf rust, and stem rust. These include Yr18/Lr34/Sr57, Yr29/Lr46/Sr58, and Yr46/Lr67/Sr55 (https://wheat.pw.usda.gov/GG3/wgc). Gene-based and closely linked molecular markers (SNP, STS and CAPS) were used to validate the presence of resistance alleles of the genes Lr34, Lr46, Lr67, Lr68, and Sr2 [72]. [73] studied the molecular breeding of wheat lines for resistance against multiple rusts and Fusarium head blight (FHB), reporting durable resistance against both the rusts and FHB by combining the six resistance genes Lr19, Lr34/Yr18/Sr57/Pm38/Ltn1, Sr2/Yr30, Sr26, Sr39, and Fhb1.

The newly evolved wheat cultivars Gem-12, Sids-14, Giza-171, and Sakha-95 exhibited improved genetic resistance traits against yellow, leaf, and stem wheat rust diseases, as indicated by the lowest FRS, AUDPC, and r-values (Tables 3 and 5). Moreover, these cultivars contained multiple rust resistance genes. The phenotypic responses to different rust infections indicated the presence of additional slow-rusting resistance genes. Marker-assisted selection can be applied to improve wheat cultivars with efficient gene combinations that would directly support the development of durable resistance in Egypt. Once the expression of the resistance genes targeted in this study have been confirmed by phenotypic screening, the preferable cultivars can be used as donors by Egyptian wheat breeders. The results of this study will help breeders determine the extent of resistance under field conditions when breeding for rust resistance in bread wheat.

Funding: The current work was funded by NRCwithin the 12tj research plan projects,through supporting project number (12050142) National Reseach Center,Giza.Egypt.

Conflicts of interest/Competing interests : All authors declare that they have no conflict of interest.

Availability of data and material :available

Code availability : no code

Authors’ contributions :AE, extracted DNA and applied PCR reaction and analyses the markers and wrote the paper

FBF, extracted DNA and applied PCR reaction and analyses the markers and wrote the paper WE, were responsible for evaluation of rust disease and wrote the section (rust disease)

MA were responsible for evaluation of rust disease and wrote the section (rust disease)

RME revised the paper and mange the whole work.

Regulation: the manuscript complies the local and national regulations.

Consent for publication: The authors declare that the work has been consented for publication.

Permissions information: Any field activities were conducted properly within the Egyptian laws and regulations by an Agriculture research center (ARC) specialist (Second author on this paper). Therefore, no specific permissions were required for locations or field activities. Furthermore, we confirm that the field studies conducted in the current study did not involve endangering indigenous or protected species.

Ethics approval and consent to participate: This article does not contain any studies with human participants or animals performed by any of the authors. The authors declare that the work is ethically approved and consented to participate.

Johnson R (1988) Durable resistance to yellow (stripe) rust in wheat and its implications in plant breeding. In Breeding Strategies for Resistance to the Rusts of Wheat N.W. Simonds and S. Ragaram (eds), CIMMYT, México. 63-75
Hasan MA, Boult OA, Abou-Zeid M, Gad MA (2016) Impact of different levels of stem and stripe rust severities on two grain yield components of wheat. Minufiya J Agric Res 41:621–629
Washington DC, Government US, Printing Office Wiese MV (1987) Compendium of Wheat Diseases. APS Press, St. Paul
Nazim M, El-Shehedi AA, Abdou YA, El-Daoudi YH (1983) Yield losses caused by leaf rust on four wheat cultivars under different epiphytotic levels. In Proc. fifth conference of microbiology, Cairo. 18-27
Kokhmetova A, Morgounov A, Rsaliev S, Rsaliev A, Yessenbekova G, Typina L (2011) Wheat germplasm screening for stem rust ResistanceUsing conventional and molecular techniques. Czech J Genet Plant Breed 47:S146–S154
Abou-Zeid MA, Elkot AF (2017) Genetic analysis of adult plant resistance genes to stem rust in some Egyptian bread wheat cultivars. Egypt J Phytopathol 45:231–248. https://doi.org/10.21608/ejp.2017.88616
Shehab-Eldeen MT, Abou-Zeid MA (2020) Quantitative studies on wheat resistance to stripe and stem rusts and on grain yield. J Plant Prot and Path, Mansoura Univ., (11):1071–1075
Barcellos AL, Roelfs AP, de Moraes-Fernandes MIB (2000) Inheritance of adult plant leaf rust resistance in the Brazilian cultivars Toropi. Plant Dis 84:90–93
Brennan PS (1975) General resistance in wheat (Triticum aestivum) to stem rust (Puccinia graminis Pers. f. sp. tritci Erikss and Henn). Ph.D. Thesis, University of Sakathewen, Saskatoon, Canada. 142
Abou-Zeid MA (2014) Identification of yellow rust resistance gene Yr 18 in Egyptian wheat germplasm by molecular markers. "2nd International Wheat Stripe Rus Symposium" Izmir, Turkey, 28 April-1 May, 2014
Anderson JA, Chao S, Liu S (2013) Molecular breeding using a major QTL for Fusarium head blight resistance in wheat. Crop Sci 47:112–119
Milus EA, Kristensen K, Hovmّller MS (2008) Increased aggressiveness of Puccinia striiformis f. sp tritici at least partially explains recent stripe rust epidemics. Phytopathology 98:S107–S107
Wellings CR (2011) Global status of stripe rust: a review of historical and current threats. Euphytica 179:129–141
Dong Z, Hegarty JM, Zhang J, Zhang W, Chao S, Chen X, Zhou Y, Dubcovsky J (2017) Validation and characterization of a QTL for adult plant resistance to stripe rust on wheat chromosome arm 6BS (Yr78). Theor Appl Genet 130:2127–2137
Zhou XL, Han DJ, Gou HL, Wang QL, Zeng QD, Yuan FP, Zhan GM, Huang LL, Kang ZS (2014) Molecular mapping of a stripe rust resistance gene in wheat cultivar Wuhan 2. Euphytica 196:251–259
Liu W, Frick M, Huel R, Nykiforuk CL, Wang X, Gaudet DA, Eudes F, Conner RL, Kuzyk A, Chen Q, Kang Z, Laroche A (2014) The stripe rust resistance gene Yr10 encodes an evolutionary-conserved and unique CC–NBS–IRR sequence in wheat. Mol Plant 7:1740–1755
Randhawa MS, Bariana HS, Mago R, Bansal UK (2015) Mapping of a new stripe rust resistance locus Yr57 on chromosome 3BS of wheat. Mol Breed 35:65
Wu J, Zeng Q, Wang Q, Liu S, Yu S et al (2018b) SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26. Theor Appl Genet 131:1481–1496
Qie Y, Liu Y, Wang M, Li X, See DR, An D, Chen X (2019) Development, validation, and re-selection of wheat lines with pyramided genes Yr64 and Yr15 linked on the short arm of chromosome 1b for resistance to stripe rust. Plant Dis 103:51–58
Elkot AF, El-Orabey WM, Draz IS, Sabry SR (2020) Marker-assisted identification of stem rust resistance genes Sr2, Sr13, Sr22 and Sr24 in Egyptian wheat cultivars. Egypt. Plant Breed 24:225–245
Pal D, Bhardwaj SC, Sharma P, Sharma D, Khan H et al (2020) Molecular marker aided selection for developing rust resistant genotypes by pyramiding Lr19/Sr25 and Yr15 in wheat (Triticum aestivum L.). Australasian Plant Pathol 49:631–640
Gautam T, Dhillon GS, Saripalli G, Rakhi SVP et al (2020) Marker-assisted pyramiding of genes/QTL for grain quality and rust resistance in wheat (Triticum aestivum L.). Mol Breed 40:1–14
Pal D, Bhardwaj SC, Sharma P, Sharma D, Kumari S, Patial M, Prabhu KV, Kumar J (2015) Molecular marker assisted backcross breeding for effective transfer of Lr19 in wheat (Triticum aestivum L.). Indian J Genet 75:253–255
Singh A, Jaiswal JP, Badoni S (2018) Enhancing rust resistance in wheat through marker assisted backcross breeding. Ind Jrnl Gen Plnt Bree 78:19–25
Qiu L, Wang H, Li Y, Wang W, Liu Y et al (2020) Fine mapping of the wheat leaf rust resistance gene LrLC10 (Lr13) and validation of its co-segregation markers. Front Plant Sci 11:470
Elshafei AA, Motawei MI, Esmail RM, Al-Doss AA, Hussien AM, Ibrahim EI, Amer MA (2021) Molecular breeding for rust resistance in wheat genotypes. Mol Biol Rep 48:731–742
Abou-Zeid MA, Mourad AMI (2021) Genomic regions associated with stripe rust resistance against the Egyptian race revealed by genome-wide association study. BMC Plant Biol 21:42. https://doi.org/10.1186/s12870-020-02813-6
Tervet I, Cassel RC (1951) The use of cyclone separation in race identification of cereal rusts. Phytopath 41:282–285
Peterson RF, Campbell AB, Hannah AE (1948) A diagrammatic scale for estimating rust intensity on leaves and stems of cereals. Can J Res 26c:496–500. http://doi.org/10.1139/cjr48c-033
Roelfs AP, Singh RP, Saari EE (1992) Rust Diseases of Wheat: Concepts and Methods of Disease Management. (2nd ed.), CIMMYT, Mexico, D.F. pp 25
Pandey HN, Menon TCM, Rao MV (1989) A simple formula for calculating area under disease progress curve. Rachis 8:38–39
Van der Plank JE (1963) In Plant Diseases: Epidemics and Control. Academic Press, New York
Snedecor GW, Cochran WG (1967) Statistical Methods, 6th edn. Iowa State University Press, Ames
Sepsi AI (2010) Molecular cytogenetic characterisation of a leaf-rust resistant wheat-Thinopyrum pontificum partial amphiploid. Doct. Dissert. Eotvos Lorand Univ. Sci. Budapest
Periyannan SK, Qamar ZU, Bansal UK, Bariana HS (2014b) Development and validation of molecular markers linked with stem rust resistance gene Sr13 in durum wheat. Crop Pasture Sci 65:74–79
Hiebert CW, McCallum BD, Thomas JB (2014) Lr70, a new gene for leaf rust resistance mapped in common wheat accession KU3198. Theor Appl Genet 127:2005–2009
Subramanian NK, Mason RE, Milus EA, Moon DE, Brown-Guedira (2016) Characterization of two adult-plant stripe rust resistance genes on chromosomes 3BS and 4BL in soft red winter wheat. Crop Sci 56:143–153
Sambasivam PK, Bansal UK, Hayden MJ, Lagudah E, Bariana HS (2008) Identification of Markers Linked with Stem Rust Resistance Genes Sr33 and Sr45
Campbell BW, Liu Y, Wise K, Jin Y, Ohm HW (2016) Inheritance and mapping of stem rust resistance of wheat line PI 410966. Cereal Research Communications 44:414–423
Olson EL, Rouse MN, Pumphrey MO, Bowden RL, Gill BS, Poland JA (2013) Introgression of stem rust resistance genes SrTA10187 and SrTA10171 from Aegilops tauschii to wheat. Theor Appl Genet 126:2477–2484
Lopez-Vera EE, Nelson S, Singh RP, Basnet BR, Haley SD, Bhavani S, Huerta-Espino J, Xoconostle-Cazares BG, Ruiz-Medrano R, Rouse MN, Singh S (2014) Resistance to stem rust Ug99 in six bread wheat cultivars maps to chromosome 6DS. Theor Appl Genet 127:231–239
Yu LX, Barbier H, Rouse MN, Singh S, Singh RP, Bhavani S, Huerta-Espino J, Sorrells ME (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theor Appl Genet 127:1561–1581
Bansal UK, Zwart R, Bhavani S, Wanyera R, Gupta V, Bariana HS (2012) Microsatellite mapping identifies TTKST-effective stem rust resistance gene in wheat cultivars VL404 and Janz. Mol Breed 30:1757–1765
Saintenac C, Zhang WJ, Salcdo A, Rouse MN, Trick HN, Akhunov E, Dubcovsky J (2013) Identification of wheat gene Sr35 that confers resistance to Ug99 stem rust race group. Science 341:783–786
Herrera-Foessel SA, Singh RP, Lan CX, Huerta-Espino J, Calvo-Salazar V, Bansal UK, Bariana HS, Lagudah ES (2015) Yr60, a gene conferring moderate resistance to stripe rust in wheat. Plant Dis 99:508–511
Abou-Zeid MA, AbdElhameed AS, Abd El-Wahab MMH (2018) Evaluation of new wheat genotypes with genetic for stem rust resistance diversity and some yield components under Egyptian field conditions. Egypt. Plant Breed 22:849–871
Draz IS, Samar M, Esmail Abou-Zeid MA, Hafez Y (2019) Changeability in stripe rust infection and grain yield of wheat associated with climatic factors. Environ Biodiv Soil Sec 2:143–153
Taye T, Fininsa C, Woldeab G (2015) Yield variability of bread wheat under wheat stem rust pressure at bore field condition of southern oromia. Journal of Agricultural Science and Food Technology 1:11-15. Retrieved from http://pearlresearchjournals.org/journals/jmbsr/index.html
Randhawa M, Bansal U, Valárik M, Klocová B, Doležel J, Bariana H (2014) Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat. Theor Appl Genet 127:317–324
Singh RP, Nelson JC, Sorrells ME (2000) Mapping Yr28 and other genes for resistance to stripe rust in wheat. Crop Sci 40:1148–1155
Yaniv E, Raats D, Ronin Y, Korol AB, Grama A, Bariana H, Dubcovsky J, Schulman AH (2015) Evaluation of marker-assisted selection for the stripe rust resistance gene Yr15, introgressed from wild emmer wheat. Mol Breed 35:43
Chen C, He Z, Lu J, Li J, Ren Y, Ma C, Xia X (2016) Molecular mapping of stripe rust resistance gene YrJ22 in Chinese wheat cultivar Jimai 22. Mol Breed 36:118
Zeng Q, Han D, Wang Q, Yuan F, Wu J, Zhang L, Wang X, Huang L, Chen X, Kang Z (2014) Stripe rust resistance and genes in Chinese wheat cultivars and breeding lines. Euphytica 196:271–284
Han DJ, Wang QL, Chen XM, Zeng QD, Wu JH, Xue WB, Zhan GM, Huang LL, Kang ZS (2015) EmergingYr26-virulent races of Puccinia striiformis f. sp. tritici are threatening wheat production in the Sichuan Basin, China. Plant Dis 99:754–760
Li B, Xu Q, Yang Y, Wang Q, Zeng Q et al (2017) Stripe rust resistance and genes in Chongqing wheat cultivars and lines. Sci Agric Sin 50:413–425
Wu J, Wang Q, Xu L, Chen X, Li B, Mu J, Zeng Q, Huang L, Han D, Kang Z (2018a) Combining SNP genotyping array with bulked segregant analysis to map a gene controlling adult-plant resistance to stripe rust in wheat line03031-1-5. Phytopathology 108:103–113
Nsabiyera V, Qureshi N, Bariana HS, Wong D, Forrest KL, Hayden MJ, Bansal UK (2016) Molecular markers for adult plant leaf rust resistance gene Lr48 in wheat. Mol Breed 36:65
Kokhmetova A, Madenova A, Kampitova G, Urazaliev R, Yessimbekova M, Morgounov A, Purnhauser L (2016) Identification of leaf rust resistance genes in wheat cultivars produced in Kazakhstan. Cereal Res Commun 44:240–250
Rani K, Raghu BR, Jha SK, Agarwal P, Mallick N et al (2020) A novel leaf rust resistance gene introgressed from Aegilops markgrafii maps on chromosome arm 2AS of wheat. Theor Appl Genet 133:2685–2694
Kiel A, Weigt D, Karpińska M, Kurasiak-Popowska D, Niemann J, Tomkowiak A, Mikołajczyk S, Nawracała J (2020) An analysis of the functionality of molecular markers related to the Lr19 gene conditioning resistance to wheat leaf rust. Zemdirbyste Agric 107:63–70
Rouse MN, Nava IC, Chao S, Anderson JA, Jin Y (2012) Identification of markers linked to the race Ug99 effective stem rust resistance gene Sr28 in wheat (Triticum aestivum L.). Theor Appl Genet 125:877–885
Babiker EM, Gordon TC, Bonman JM, Chao S, Rouse MN, Brown-Guedira G, Williamson S, Pretorius ZA (2016) Rapid identification of resistance loci effective against Puccinia graminis f. sp. tritici race TTKSK in 33 spring wheat landraces. Plant Dis 100:331–336
Zhang X, Rouse MN, Nava IC, Jin Y, Anderson JA (2016) Development and verification of wheat germplasm containing both Sr2 and Fhb1. Mol Breed 36:85
Mahmood Z, Aziz A, Andleeb T, Tanveer SK, Waqar S, Qamar M, Abbass SH, Rafique T, Ali M, Uddin S, Hasan SW (2020) Screening of resynthesized hexaploid wheats for durable rust resistance. Int J Agric Biol 24:621–630
Kolmer JA, Singh RP, Garvin DF, Viccars L, William HM, Huerta-Espino J, Ogbonnaya FC, Raman H, Orford S, Bariana HS, Lagudah ES (2008) Analysis of the Lr34/Yr18 rust resistance region in wheat germplasm. Crop Sci 48:1841–1852
Lu Y, Lan C, Liang S, Zhou X, Liu D, Zhou G, Lu Q, Jing J, Wang M, Xia X, He Z (2009) QTL mapping for adult-plant resistance to stripe rust in Italian common wheat cultivars Libellula and Strampelli. Theor Appl Genet 119:1349–1359
Singh RP, Rajaram S (1994) Genetics of adult plant resistance to stripe rust in ten spring bread wheats. Euphytica 72:1–7
Qureshi N, Bariana H, Forrest K, Hayden M, Keller B, Wicker T, Faris J, Salina E, Bansal U (2017) Fine mapping of the chromosome 5b region carrying closely linked rust resistance genes Yr47 and Lr52 in wheat. Theor Appl Genet 130:495–504
Pal D, Bhardwaj SC, Patial M, Kumar S, Gangwar OP, Sharma P, Prabhu KV (2019) Transfer of leaf rust and stripe rust resistance genes Lr19 and Yr15 in to a susceptible wheat cultivar HS295. Indian J Genet 79:618–621
Periyannan S, Bansal U, Bariana H, Deal K, Luo MC, Dvorak J, Lagudah E (2014a) Identification of a robust molecular marker for the detection of the stem rust resistance gene Sr45 in common wheat. Theor Appl Genet 127:947–955
Caldwell RM (1968) Breeding for general and/or specific plant 336 disease resistance Proc 3rd integratif wheat genetics Sym. Australian Academy of Science, Canberra, pp 263–272
Huerta-Espino J, Singh R, Crespo-Herrera LA, Villaseñor-Mir HE, Rodriguez-Garcia MF, Dreisigacker S, Barcenas-Santana D, Lagudah E (2020) Adult plant slow rusting genes confer high levels of resistance to rusts in bread wheat cultivars from Mexico. Front Plant Sci 11:824
Maré A, Boshoff WHP, Herselman L (2020) Molecular breeding of wheat lines for multiple rust and Fusarium head blight resistance. Euphytica 216(10):1–12

suplmentarydata.doc

Download PDF

Journal Publication

published 29 Nov, 2021

Read the published version in Molecular Biology Reports →

Editorial decision: Major Revisions Needed
03 Nov, 2021
Reviewers invited by journal
15 Oct, 2021
First submitted to journal
06 Oct, 2021

You are reading this latest preprint version

Phenotyping and Validation of Molecular Markers Associated With Rust Resistance Genes in Wheat Cultivars in Egypt

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Disease assessment

Statistical analysis

DNA extraction and SSR analysis

Data handling

Results

Validation of resistance genes (yellow, leaf, and stem rust) in wheat cultivars

Validation of markers linked to yellow rust resistance genes

Validation of markers linked to leaf rust resistance genes

Validation of markers linked to stem rust resistance genes

Validation of markers linked to leaf/yellow rust resistance genes

Validation of markers linked to stem/yellow rust resistance genes

Identification of wheat cultivars containing more than one rust resistance dieses

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1