Animal studies
Six to eight-week-old C57BL/6 mice purchased from the Experimental Animal Center of the Fourth Military Medical University were randomly divided into six animals per cage and housed at 24 ± 2 °C, relative humidity 50–60%, and a 12 h light-dark cycle. All animals had free access to food and water. All mice were acclimatized in the laboratory environment for at least one week.
Mice were randomly divided into five groups (n = 8 in each group): the control group, model group (I/R), OMT (LOT:19111302, Shanghai Pure Excellent Biology) low-dose group (1 mg/kg), OMT medium-dose group (10 mg/kg), and OMT high-dose group (100 mg/kg). OMT was intraperitoneally administered to the mice in the drug administration groups 30 min after the MCAO operation, the mice were then anesthetized with pentobarbital sodium (50 mg/kg) 24 h after reperfusion, and their brain tissue was collected for subsequent experiments.
Middle Cerebral Artery Occlusion (MCAO) Model
To establish the MCAO model, mice were prepared by suture embolization, as described previously [14]. Briefly, the mice were anesthetized by administering an intraperitoneal injection of pentobarbital sodium (1%), held in a supine position, and a 1-cm midline incision was made along the neck. The left common carotid artery (CCA), the external carotid artery (ECA), and the internal carotid artery (ICA) were identified and carefully dissected free from the surrounding nerves and fascia. A cable was attached to the distal end of the CCA and ECA. A temporary clip was placed on the ICA along with the arteriole, near the heart, and then ligated with the CCA. A small opening was then cut into the ECA, and an anchored line (MSMC21B120PK50, RWD Life Science) was inserted into the CCA, and the ECA was cut to insert the anchored line into the ICA. The line plug was inserted at approximately 10 mm from the fork mouth and fastened with the ECA, after which the CCA telecentric end thread was loosened and a surgical suture was performed around the ECA stump. The sham group was treated the same way but without a plug. Throughout the procedure, the mouse body temperature was maintained at 37 °C. An hour and a half after the procedure, the line plug was pulled out to allow the brain tissue reperfusion. Brain samples were collected 24 h after reperfusion. Blood flow was monitored in the MCAO mice using a laser speckle Doppler flowmeter (RFLSI III, RWD Life Science). Mice with blood flow reduction < 30% and/or those with an mNSS score of fewer than 7 points were excluded.
Neurological Score
The improved mNSS scoring system was used for the neurological scoring test 24 h after reperfusion. The evaluation included five tests, including the tail suspension test, platform crawling test, sensory test, bar balance test, reflex test, and abnormal movement test. The highest possible score was 18[15].
Evaluation of Brain Infarct Volume
Twenty-four hours after reperfusion, the mice were sacrificed, and brain tissue was immediately harvested. After a 20 min incubation at -20 ˚C, the brain was placed in the brain slot of a vibratome and sliced into uniform 2 mm-thick slices from the bifurcation of the miter joint. The brain tissue sections were dyed at 37 °C for 30 min in 2% triphenyltetrazolium chloride (TTC) and fixed with 4% paraformaldehyde for 24 h. Digital images of the brain were then taken, and the cerebral infarction area was calculated. The infarct was observed as a white region while the normal brain had a red color. The infarct area was measured using Image J.
Nissl Staining
As determined by the neurological score, mice that showed neural defects were perfused with normal saline and fixed with 4% paraformaldehyde. Their brains were then resected and fixed in 4% paraformaldehyde for 4 h at 4 °C, then dehydrated by passing through a 20% sucrose solution and then a 30% sucrose solution 24 h. The brain was then cut into twenty-five thick cerebral slices containing hippocampal and cortical tissues using a cryotome and placed directly on an adhesive slide. The sections were then stained with 0.1% tar purple dye for 10 min and then washed several times with clean water. The sections were then dehydrated with a 75%, 95%, and 100% ethanol gradient (1 m in each solution). Finally, the sections were placed in xylene for 10 min and then mounted on a neutral gum slide. The sections were then observed under a high-powered bright-field microscope (Nikon Ni), and digital images were obtained. Cells with distinct nucleoli were identified as intact and undamaged cells.
TUNEL Staining
After fixing the mouse brain with 4% paraformaldehyde solution and gradient dehydration, the sections were brought to room temperature. Next, the sections were incubated with a solution containing 0.2% H2O2 and methanol for 0.5 h to prevent endogenous peroxidase activity. They were then treated with the TUNEL reaction mixture (Roche) at 37 °C for 60 min. The TUNEL positive and negative cells were counted by fluorescence microscopy (OLYMPUS IX 53 + DP 73). The result is expressed as an apoptosis index, calculated as follows: (TUNEL positive cells)/(total cells) × 100%.
Evans Blue Leakage Detection
The permeability of BBB was determined using the Evans blue dye. Mice were administered 2% Evans blue by the tail vein injection (2 mL/kg) 90 min before sacrifice. After resecting the brain, it was weighed and homogenized in 1:3 (W/V) 50% trichloroacetic acid (TCA) and was centrifuged (12000 × g, 15 min). The supernatant was then used for the Evans blue colorimetric assay. The supernatant absorbance was determined at 620 nm using a microplate spectrophotometer to calculate the Evans blue transmittance.
Determination of Brain Water Content
Brain specimens were collected 24 h after reperfusion, and the cerebellum and hydrangea were removed, and the ischemic hemispheres were taken and weighed immediately (wet weight). They were then dried in an oven at 105 °C for 72 h and then weighed (dry weight). The percentage of brain water content was calculated as [(wet weight - dry weight)/ wet weight] × 100%.
Cell Culture
Mouse brain microvascular endothelial cell line, bEnd.3, was obtained from Sixin Biotechnology, Shanghai, China, and maintained in endothelial cell complete medium at 37 °C and 5% CO2. Dulbecco's Modified Eagle Medium (DMEM) (AF29498406, HyClone) + 10% fetal bovine serum (2206993CP, Gibco) + 1% penicillin and streptomycin mixture (20191028, Solarbio), The culture medium was changed every 2 days.
Oxygen Glucose Deprivation (OGD) Model
To simulate ischemic/reperfusion conditions in vitro, bEnd.3 cells were reperfused after oxyglucose deprivation. Briefly, bEnd.3 cells were washed three times with phosphate-buffered saline (PBS), and the normal medium was replaced with DMEM without glucose (2120596, Gibco). The cells were then transferred to a hypoxic chamber (95% N2 / 5% CO2, MIC-101, USA, Billups-Rothenberg) and incubated at 37 °C for 2 h. They were then cultured for another 24 h under standard culture conditions.
Cell Counting Kit-8 (CCK-8) Assay
Cell viability was measured using the CCK-8 assay. Cells (4 × 103) were plated in each well of a 96-well plate. After 24 h of pre-culture in the incubator, 10 µL CCK-8 reagent (BS350B, Biosharop) was added to each well after OGD modeling and administration. After incubation in the incubator for 1 h, the absorbance value at 490 nm was determined using a microplate reader. The absorbance was normalized to a reagent blank to calculate the cell viability.
Annexin-V/PI double staining Assay
Apoptosis was detected by Annexin-V/PI double staining. Briefly, 1 × 106 cells were plated in each well of a 6-well plate. Cells were harvested and incubated with Annexin-V-FITC (5 µL) in the dark for 15 minutes at room temperature, after which 5 µL PI staining solution was added and incubated for 5 min. After adding 200 µL Binding Buffer, the cell fluorescence was detected using flow cytometry immediately. The number of cells positive for Annexin-V-FITC and PI was used to calculate the apoptosis rate.
Transendothelial Electrical Resistance (TEER)
TEER values were measured using a Millicell-ers cell resistor (Millipore, USA) equipped with chopstick electrodes to assess the integrity of the bEnd.3 monolayer cell barrier. Briefly, 2 × 105 cells were plated in the upper chamber of a transwell insertion chamber (3460; Corning, NY, USA) in 0.5 mL DMEM, and 1.5 ml of the same medium was added to the lower chamber to prevent the formation of a pressure gradient. Studies have shown that bEnd.3 cells have the highest TEER value on the 7th day, so this time point was selected to detect the TEER value. The TEER value (Ω cm2) was calculated after subtracting the resistance value of the blank transwell culture chamber without cells and multiplying it with the area of the upper culture chamber (1.13 cm2).
FITC-dextran Permeability Test
After 1.5 h of OGD followed by 24 h of reoxygenation, the culture medium in the upper and lower chambers of the transwell was replaced with a culture medium free of nutritional factors in preparation for the permeation experiment. During the penetration experiment, FITC-Dextran (MW 1000, 10 kDa) was added to the transwell upper chamber at a 1 mg/kg concentration in DMEM. After incubating for 30 min, 100 µl of the media from the lower chamber was collected, and the fluorescence intensity was detected using a VICTOR Nivo multimode plate reader (PerkinElmer, UK) at an excitation/emission of 490/ 520 nm.
Lentiviral constructs and shRNA for Cav-1
Cav-1 lentivirus vectors with a GFP tag were constructed by Genepharma (Shanghai, China). To generate the Cav-1 short hairpin RNA (shRNA),the target sequence was designed against mouse Cav-1: AAGGAGATTGACCTGGTCAAC 32.Microinjection of lentivirus into the lateral ventricle of the mouse brain interferes with the expression of Cav-1. Briefly, the mice were anesthetized by intraperitoneally injecting 1% sodium pentobarbital. The anesthetized mouse was placed in a stereotaxic device, the head hair shaved to expose the scalp, and an incision was made. The front chimney point of the mouse head was identified, and the coordinates were recorded. The position of the lateral ventricle (0.3 mm behind the front chimney point, 1.0 mm left and right, depth: 2.2 mm) was then estimated. A fine hole was then drilled in the skull in the bilateral ventricle area, and the needle was placed into the bilateral ventricle. The needle was allowed to rest for 10 min, after which 2 µl lentivirus was slowly injected using a micro-syringe at a speed of 0.2 µl/ min. After the injection, the needle remained in place for 10 min, and then slowly pulled out. The scalp was sutured, and an anti-bacterial ointment was applied to prevent infection.
Western Blotting Analysis
Western blot was used to detect the protein expressions of CAV-1, MMP-9, MMP-2, occludin, ZO-1, P-gp, AQP-4, and occludin. Briefly, the brain tissue was homogenized in a lysis buffer containing protease inhibitor and phosphatase inhibitors. The total protein content was determined using a BCA protein assay. Equal amounts of proteins were resolved by SDS-PAGE and then transferred onto a PVDF membrane (Invitrogen, Carlsbad, California, USA). The membrane was blocked with 5% skim milk/TBST (pH 7.6) for 1 h. The membrane was then incubated with the primary antibodies – CAV-1 (ab2019, Abcam, 1:1000), MMP-9 (ab38898, Abcam, 1:1000), MMP-2 (10373-2-AP, Proteintech, 1:1000), occludin (13409-1-AP, Proteintech, 1:1000), ZO-1 (21773-1-AP, Proteintech, 1:1000), P-gp (ab170904, Abcam, 1:1000), AQP-4 (ab46182, Abcam, 1:1000), or actin (059M4770v, Sigma, 1:10000) – at 4 ° C overnight. After incubation, the membrane was washed three times with TBST buffer and incubated with the corresponding secondary antibody (1:10,000). After incubation at room temperature for 1 hour, the membrane was washed three times with TBST. Protein bands were visualized under a chemiluminescence imager. The bands were quantified using Image J, and the relative band density to β-actin was calculated[16]. The control ratio was set at 100%, and the intensity of the treatment groups was expressed as a percentage relative to the control group.
Statistical Analysis
All results are expressed as mean ± SD, and statistical analysis was conducted using Prism (GraphPad, San Diego, CA, USA) software. Two-tailed student's t-test was used for mean comparison between two groups, and one-way analysis of variance (ANOVA) was used for mean comparison between multiple groups (three groups or more). P < 0.05 was considered statistically significant.