Cell culture, plasmids and transfection
Huh7.5 cells were provided by Dr. Charles Rice, (Rockefeller University, New York, NY, USA), HepG2 cells were provided by Dr. Tiangang Li (University of Kansas Medical Center, Kansas, KS), SK-Hep1 cells were purchased from ATCC (Manassas, VA). All cells were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen, Grand Island, NY) containing 10% fetal bovine serum (FBS), 50 U/ml penicillin and 50 mg/ml streptomycin. Flag-SIRT7, proE-cad670-Luc (E-cadherin promoter region from -670 to +92) plasmids were respectively provided by Drs Eric Verdin, Kumiko Ui-Tei via Addgene (Cambridge, MA). To generate mutants of E-cadherin luciferase reporter plasmids, proE-cad670-Luc was used as template and mutants were reconstituted by using the Q5 Site-Directed Mutagenesis Kit from New England BioLabs (Ipswich, MA). Cells were transfected in serum-free medium (Opti-MEM, Invitrogen) by using X-tremeGENE™ HP DNA Transfection Reagent (Roche, Indianapolis, IN) as previously described(24). siRNA targeting SIRT7 (SMARTpool: ON-TARGET plus human SIRT7 siRNA), shRNA targeting SIRT7 (MISSION® esiRNA targeting human SIRT7) and shRNA targeting FOXO3 (MISSION® TRC shRNA TRCN0000040100) were purchased from GE Dharmacon (Lafayette, CO) and Sigma-Aldrich (St. Louis, MO), respectively.
Antibodies and Chemicals
Anti-SIRT7 (D3K5A), anti-SIRT1 (D1D7), anti-β-actin (8H10D10), anti-FOXO3 (75D8), anti-E-cadherin (24E10) were purchased from Cell Signaling Technology (Boston, MA). Anti-GAPDH (FL-335) anti-α-SMA (SC53124) and anti-Vimentin (SC6260) were purchased from Santa Cruz Biotechnology (Dallas, TX). Anti-beta actin (AC-15), and anti-Flag (M2) were purchased from Sigma-Aldrich. Anti-SIRT7 (PA5-87543) was purchased from Invitergen. Daidzin, Fomepizole, dially sulfide (DAS), N-acetyl-L-cysteine (NAC), 4-Hydroxynonenal (4-HNE) were purchased from Sigma-Aldrich.
Animal model
Male NSG mice (4 weeks of age) were purchased form The Jackson Laboratory (Bar Harbor, ME) and Gempharmatech (Nanjing, China). Mice were housed in a temperature-controlled, pathogen-free environment with 12-hour light-dark cycles. All animal handing procedures were approved by the Institutional Animal Care and Use Committees at The University of Kansas Medical Center (Kansas City, KS) and Hunan Normal University School of Medicine (Changsha, China).
Mice received a single tail vein injection of 1x106 cells suspended in 100 μL DMEM and tumor formation was determined in lung 4 weeks after injection by using Hematoxylin &Eosin (H&E) staining. Alcohol feeding procedures were previously described (25). One week after cell injection, mice were initially fed the control Lieber-DeCarli diet ad libitum for 5 days to acclimatize them to a liquid diet. Then mice were subsequently allowed free access to the ethanol Lieber-DeCarli Diet containing 5% (vol/vol) ethanol for 2 weeks, and control-fed groups were pair-fed with an isocaloric control diet. All mice were sacrificed 4 weeks after injection and lungs were collected for determining tumor formation. Liver sections from CYP2E1-/- and control mice were kindly provided by Dr. Laura Nagy as previously described (26).
Human specimens and immunohistochemistry
De-identified human liver specimens from liver explants were obtained from The University of Kansas Medical Center, The First Affiliated Hospital of Chongqing Medical University, and The Affiliated Hospital of Hunan Normal University (People’s Hospital of Hunan Province). Written informed consent was obtained from all patients and all studies using human tissue samples were approved by the Human Subjects Committee of the University of Kansas Medical Center, Chongqing Medical University and Hunan Normal University School of Medicine.
Immunohistochemistry was performed as previously described(23, 25). After deparaffinization and rehydration, antigen retrieval was achieved by heating in a pressure cooker for 5 min in 10mM of sodium citrate (pH6). Peroxidase activity was blocked by incubation in 3% H2O2 for 10 minutes. Sections were rinsed three time in PBS/PBS-T (0.1% Tween-20) and incubated in Dako Protein Block (Dako, Agilent Technologies, Santa Clara, CA) for 10 minutes. After removal of blocking solution, slides were placed into a humidified chamber and incubated overnight with primary antibodies in blocking buffer (4% normal goat serum in PBS) and incubated over night at 4 °C. After washing, slides were covered with SignalStain Boost IHC Detection Reagent (Cell Signaling Technologies, Boston, MA) for 30 min at room temperature. After washing two times with PBS-T, the Substrate-Chromgen Solution (VECTOR NovaRED, Substrate Kit, Vector Laboratories, Burlingame, CA) was applied, slides were incubated 5-10 min and counterstained with Hemtoxylin. Images were acquired using a Nikon Eclipse 80i microscope (Nikon Americas Inc., Melville, NY).
Isolation of human and mouse primary hepatocyte
Primary human hepatocytes were freshly isolated from liver resections as previously described (24, 27) by the Cell Isolation Core of the Department of Pharmacology at the University of Kansas Medical Center. All human tissues were obtained with informed consent from each patient, according to ethical and institutional guidelines. The study was approved by the Institutional Review Board at the University of Kansas Medical Center.
Mouse primary hepatocyte were isolated by using a multi-step collagenase procedure (27). In brief, the liver was perfused with calcium-free solution and then digested with a collagenase (Sigma-Aldrich) perfusion. Dispersed cells were released from the isolated liver, hepatocytes were collected by 50×g centrifugation and then seeded on collagen coated plates and allowed to attach in a humidified 37 °C, 5% CO2 incubator for 12 h and treated with 50mM ethanol for indicated times
Quantitative polymerase chain reaction (qRCR)
Total RNA was isolated from cells using the TRIzol reagent (Thermo Fisher Scientific, Inc.), followed by cDNA synthesis using an RNA reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). Subsequently, a CFX96 real-time system (Bio-Rad, Hercules, CA, USA) was used to perform qPCR. Reaction volumes of 20 µl were used, containing 10μl of the SYBR Green PCR master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). Primer sequences for human SIRT7 and E-cadherin are as following: SIRT7-forward: 5'-GACCTGGTAACGGAGCTGC-3', SIRT7-reverse:5'-CGACCAAGTATTTGGCGTTCC-3'; E-cadherin forward: 5’- GGGGTCTGTCATGGAAGGTG -3’, E-cadherin reverse: 5’- CAAAATCCAAGCCCGTGGTG -3’;GAPDH forward:5'-GAAGGTGAAGGTCGGAGTC-3', GAPDH reverse: 5'-GAAGATGGTGATGGGATTTC-3'.
Chromatin immunoprecipitation (ChIP) assay
ChIP assays were performed as described previously(23, 24). Briefly, cells were fixed, washed, and harvested, followed by shearing of genomic DNA by sonication. Sonicated DNA (20 µl) was purified and 1% of DNA was used as input DNA control. Chromatin-bound DNAs were immunoprecipitated using antibodies as indicated. The eluted DNA from the beads was precipitated and analyzed by PCR using multiple primer sets as following: pro-Ecad A forward: 5’-GGCTGCTAGCTCAGTGGCTC-3’, pro-Ecad A reverse: 5’-TGGGCTCAAGCGGTCCTCT-3’; pro-Ecad B forward: 5’-AACTCCAGGCTAGAGGGTCACC-3’, pro-Ecad B reverse: 5’- GGCTGGAGTCTGAACTGACTTCC -3’
Western blot analysis
Total cell lysates prepared from cells were used for detection. Briefly, cells were washed twice with chilled PBS and then cell lysis was performed using the RIPA buffer (50 mM Tris, pH 7.5, 150 mM sodium chloride, 1% NP-40, 0.2% SDS, 0.5% sodium deoxycholate, 0.1 mM EDTA, and 1% protease and phosphatase inhibitors (Sigma-Aldrich). After centrifugation at 16,000 g for 15 min, supernatants were collected. Cell lysates (25 μg) were separated on a 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Immobilon-P membranes; EMD Millipore, Billerica, MA, USA). Membranes were blocked with blocking buffer (5% skim milk, 0.1% Tween-20 in PBS) for 1 h at room temperature. Following incubation with primary antibodies (1:1000) overnight at 4°C, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific, Inc. Waltham, MA, USA). Signals were detected using the ECL Western Blotting Detection system (Thermo Fisher Scientific, Inc).
Immunofluorescence
For indirect immunofluorescence, cells grown on coverslips were fixed with 4% paraformaldehyde at room temperature for 5 min and 0.2% Triton X-100 was used for cell permeation. The coverslips were inverted on 40-μl droplets of the blocking buffer (4% goat serum) and incubated at room temperature for 45 min to prevent non-specific binding. Subsequently, cells were incubated with primary antibodies for 1 h at room temperature. Coverslips were washed with PBS, followed by incubation for 1 h at room temperature in the dark with Alexa Fluor-conjugated secondary antibodies (1:5,000; Molecular Probes; Thermo Fisher Scientific, Inc.). Additionally, Dihydrochloride (DAPI) was added for 5 min at room temperature to stain nuclear DNA. Images were acquired using a Nikon Eclipse microscope (Nikon Corporation, Tokyo, Japan).
Wound healing assay
2×104 cells were plated in 24-well plates. When cells reached 100% confluence, sterile pipette tips (100 μl) were used to scratch the wound. Cell motility was assessed by measuring the movement of cells into the scratched wound after 24h incubation.
Migration assay
The 24-well transwell plates (0.4 μm pore size, Corning, Tewsbury, MA) were used to measure the migration ability of the cells. HCC cells (2×103) in 200 μl FBS-free media were added into the upper chamber, whereas 600 μl of the media with 10% FBS was added into the bottom chambers. Cells were fixed with methanol after a 48h incubation. Cells left on the membrane in the top chamber side were wiped off with a cotton swab, whereas the cells that migrated through the membrane were stained with crystal violet. The number of migratory cells in 10 random fields was counted under a microscope.
Statistical Analysis
Data are presented as mean ± sem. Statistical significance between groups was calculated by using one-way ANOVA followed by Turkey’s test. Statistical significance between two groups was calculated by 2-tailed unpaired Student’s t-test. Variance between groups met the assumptions of the appropriate test. Unless otherwise stated, a P-value of <0.05 was considered statistically significant. The Kaplan–Meier method was used to estimate the survival rates for SIRT7 expression. Equivalences of the survival curves were tested by log-rank statistics.