Virus and Cells
PRV-GDFS (GenBank No. MH521043) was isolated from Guangdong Province of China in 2019, which had belonged to the variant PRV strain. PK-15 cells (ATCC No. CCL-33) were cultured in Dulbecco’s modified essential medium (DMEM; Invitrogen, USA) with 10% fetal bovine serum (HyClone, USA) and 5% CO2 at 37°C in a humidified incubator.
Construction of transfer plasmid and sgRNA plasmids
A transfer plasmid was constructed by using two segments flanking the gI and US2 genes (Fig. 1A). The fragments of gI-L and US2-R were amplified by polymerase chain reaction (PCR) with gD-F/gI-R and US2-F/US2-R primers. Then, the two PCR products were inserted into the pBluescript II SK (pSK) vector. Finally, the transfer plasmid pSK-gIL-US2R was obtained, as the recombination homologous arms. The pCas9-gI targeting site was 5′-TACGACCCCGCGTCCCCCG-3′, and the pCas9-US2 targeting site was 5′-GGGGTGACGGCCATCACCG-3′. The guide RNAs were synthe-sized and cloned into the PX335 plasmids [25]. All the sequences of the primers and sgRNAs are listed in Table 1.
Table 1
Sequences of oligonucleotides used in this study.
Primer
|
Sequence
|
Details
|
gD-F
|
TCTCGAGGAGGACCCGTGCGGGGTGGTGGCG
|
Left
Homologous arm
|
gI-R
|
TGAATTCGCAGGCGCGCTTGGGGTCGAGGCGC
|
US2-F
|
TACTAGTGCTGGACACGGAGTGGTCGTCCGTCC
|
Right Homologous arm
|
US2-R
|
TGCGGCCGCGTGAGGCGGGCCGCGCCCCGCTCT
|
sgRNA-gI-F
|
CACCGTACGACCCCGCGTCCCCCG
|
sgRNA-gI
|
sgRNA-gI-R
|
AAACCGGGGGACGCGGGGTCGTAC
|
sgRNA-US2-F
|
CACCGGGGGTGACGGCCATCACCG
|
sgRNA-US2
|
sgRNA-US2-R
|
AAACCGGTGATGGCCGTCACCCCC
|
gI/US2-F
|
ACCACCGCCGCGCCGGGCGTCTCGCGCCAC
|
Identify the deleted genes
|
gI/US2-R
|
GGCCAGCGAGCCGGGGGAGATCTCCGAGGA
|
Generation of PRV GDFS-delgI/gE/US9/US2 using CRISPR/Cas9
The homologous recombination and CRISPR/Cas9 technology were used simultaneously to gene-delete virus. Co-transfection was conducted in PK-15 cells using Lipofectamine 2000 (Invitrogen, USA) following the manufacturer’s instructions. In brief, 4 µg of pSK-gIL-US2R plasmid, 8 µg of PRV-GDFS genome, and 1 µg of pX335-sgRNAs (0.5 µg of pX335-gIsgRNA and 0.5 µg of pX335-US2sgRNA) were co-transfected to PK-15 cells as previously described. After the cytopathogenic effect (CPE), the cells were collected and subjected to 3 cycles of freezing and thawing. The PRV GDFS-delgI/gE/US9/US2-deleted virus was generated through plaque purification assay. The recombinant virus was identified by PCR test using gI/US2-F/R specific primers (Table 1), and the genetic stability was validated by consecutive culture of cells.
Immunofluorescence assay
PK-15 cells cultured to 90% confluence in 12-well plates were infected with PRV GDFS-delgI/gE/US9/US2 at an MOI of 0.1, and the PRV GDFS wild-type strain served as the positive control. Twenty-four hours after the infection, the infected cells were fixed using cold methanol:acetone (1:1), followed by washing with PBS. Then, the cells were blocked in blocking buffer (5% bovine serum albumin in PBS) and incubated with anti-gE mAbs or anti-gB mAbs (1:100 dilution; the monoclonal antibodies were provided by Doctor Bo Hou,unpublished data. PRV gE or gB gene was cloned into pET28a vector. These recombinant proteins were then expressed and purified by the prokaryocyte ex-pression system. These recombinant proteins (gE or gB protein) have been immunized in mice. Then the mouse spleen cells were fused with cell line SP2/0 cells in order to prepare monoclonal antibody. Eventually the monoclonal antibodies (anti-gE or anti-gB mAbs) were prepared). After washing three times with PBS, the cells were incubated with FITC-conjugated goat anti-mouse antibody (1:500 dilution, ABclonal, Wuhan, China). The cells were investigated under a fluorescent microscope (Olympus IX73, Japan).
Animal experiments
Safety experiment
Twenty 5 to 7-day-old suckling piglets were purchased from a PRV-negative pig farm. The suckling piglets were confirmed to be seronegative for PRV using a PRV-specific gE and gB antibody ELISA kit (IDEXX, USA) and randomly divided into four groups of five. The piglets in Group A (negative-control group) were injected intramuscularly with 1 mL of DMEM. The piglets in Group B (positive-control group) were injected intramuscularly with a single dose of commercial Bartha-K61 vaccine (105TCID50/Dose). The piglets in Group C were injected intramuscularly with 105 TCID50 PRV GDFS-delgI/gE/US9/US2. The piglets in Group D were injected intramuscularly with 106 TCID50 PRV GDFS-delgI/gE/US9/US2. The pigs were housed in the negative-pressure facility of Wuhan Keqian Biology Co., Ltd (Wuhan, China), and the different groups were placed in separate rooms to avoid cross infection. All the experimental materials were strictly checked to avoid cross pollution [26]. Before formal experiments, the pathogenic microorganisms such as PCV2, PRRSV, CSFV, etc in the pigs had been checked through the real time quantitative PCR [26]. All the pigs were checked daily for their rectal temperature, and clinical signs (respiratory symptoms: sneezes, breathlessness, and nasal discharges; neurologic symptoms: opisthotonos and ataxia) were recorded throughout the experiment.
Efficacy experiment
Twenty 5 to 7-day-old suckling piglets free of PRV antibodies were randomly divided into four groups, with five piglets per group. The pigs in Group A (negative-control group) were injected intramuscularly with 1 mL of DMEM. The piglets in Group B (positive-control group) were injected intramuscularly with a single dose of a commercial Bartha-K61 vaccine (HIPRA, Spain). The piglets in Group C were injected intramuscularly with 105 TCID50 PRV GDFS-delgI/gE/US9/US2. The piglets in Group D were injected intramuscularly with 106 TCID50 PRV GDFS-delgI/gE/US9/US2. The pigs were housed in the negative-pressure facility of Wuhan Keqian Biology Co., Ltd (Wuhan, China), and the different groups were placed in separate rooms to avoid cross infection. All the experimental materials were strictly checked to avoid cross pollution [26]. Before formal experiments, the pathogenic microorganisms such as PCV2, PRRSV, CSFV, etc in the pigs had been checked through the real time quantitative PCR [26]. All the piglets at 28 days post-primary immunization (DPI) were challenged intranasally with a 108.0 TCID50 dose of the virulent PRV GDFS strain.
After the PRV challenge, all the piglets were checked daily for their rectal temperature, and clinical signs (respiratory symptoms: sneezes, breathlessness, and nasal discharges; neurologic symptoms: opisthotonos and ataxia) were recorded throughout the experiment. The body weights of all the pigs were individually measured at 0 days post-challenge (DPC) (challenge) and 14 DPC (necropsy). The average weight gain was calculated and analyzed.
Serological tests
Serum samples were collected at 0, 7, 14, 21 and 28 DPI, and the PRV-specific gB and gE antibodies in the serum were detected using ELISA kits (IDEXX, USA) according to the manufacturer’s instructions.
The serum neutralization test was performed as described previously [16]. Fifty microliters of serum samples were serially diluted twofold and mixed with a 100 TCID50 concentration of the PRV GDFS strain or PRV Ea strain at 37°C for 60 min. The mixture was added to confluent PK-15 cells cultured in 96-well plates and then incubated at 37°C under 5% CO2 for 4 days. The cells were investigated under a microscope for the CPE. The titers of neutralization antibodies were calculated as the reciprocals of the highest serum dilutions at which no CPE was observed [16].
Viral shedding
Nasal swab samples were collected at 0, 2, 4, 6, 8, 10, 12 and 14 DPC, and were clarified through centrifugation. The supernatant samples were passed through a sterile 0.22-micron filter and serially diluted tenfold. Then, the diluted samples were used to inoculate PK-15 cells on 96-well culture plates. The viral titers of the nasal swab samples were calculated as the TCID50.
Necropsy and histopathological examination
At 14 DPC, piglets from each group were euthanized. A complete necropsy of each animal was performed. Samples were collected and fixed in 10% neutral-buffered for-malin. The tonsils and brain were histopathologically examined with HE staining.
Statistical analysis
Statistical analysis was conducted using the GraphPad prism 6.0 (GraphPad Software, USA). One-way ANOVA was used for statistical analyses among different groups. P < 0.05 was defined as statistically significant difference.