Human tissue samples and cell lines
Pair-matched tumorous and adjacent nontumorous gastric tissues from 33 patients undergoing resection for gastric cancer were obtained from Sun Yat-Sen Memorial Hospital of Sun Yat-Sen University (Guangzhou, China). Tissue microarray (TMA) containing 107 gastric cancer tumor tissue constructed as described in our previous study [24]. The study was carried out in accordance with the Declaration of Helsinki (2000). Prior patients’ consent and approval from the Research Ethics Committee of Sun Yat-Sen Memorial Hospital were obtained. Human gastric carcinoma cell lines AGS, SGC7901, HGC-27 and BGC-823 were obtained from Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). Non-malignant human gastric epithelial immortalized cell line GES-1 was purchased from Beijing Institute for Cancer Research Collection. All cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (Gibco).
RNA Isolation And Quantitative RT-PCR
Total RNA from tissue samples and cell lines was extracted using TRIzol (Invitrogen) following the manufacturer’s protocol. cDNA was synthesized from 1 µg of total RNA using the PrimerScript RT-PCR kit (Takara Bio, Otsu, Japan). Mature miRNAs were reverse transcribed using the M-MLV reverse transcriptase (Promega). The mature miRNA sequence-specific stem-loop primers were: miR-543, 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGAAG-3’; U6, 5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC-3’. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was done in a Roche LightCycle480 Real-Time PCR System using the SYBR Premix Taq Ⅱ (Takara Bio, Otsu, Japan). For quantification of mRNA levels, the real-time PCR primers were as follows: TWIST1 forward primer, 5’- AGTCTTACGAGGAGCTGCAGACG-3’; TWIST1 reverse primer, 5’-AGGAAGTCGATGTACCTGGCCG-3’; GAPDH forward primer 5’-GCACCGTCAAGGCTGAGAAC-3’; GAPDH reverse primer 5’-TGGTGAAGACGCCAGTGGA-3’. For quantification of miRNA levels, the forward quantitative PCR (qPCR) primers used were as follows: miR-543, 5’-CGGCGGAAACATTCGCGG-3’; U6, 5’-TGCGGGTGCTCGCTTCGGCAGC-3’. The reverse qPCR primer 5’-CCAGTGCAGGGTCCGAGGT-3’ was used to the above miRNA. The relative transcript level of mRNA or mature miRNA was calculated using the 2−ΔΔCt method. The transcription levels of human U6 or GAPDH were used as an endogenous control.
Stabe miRNA expression cell lines
Lentiviruses containing GFP-miR-543 or GFP-negative control miRNA vector were purchased from Genepharma, Inc (Shanghai, China). SGC7901 and AGS cells were pre-seeded in a 6-well plate overnight and infected with 100 μl of virus. Infected cells were selected by adding 400 ng/ml puromycin for 5 days. Stable cell lines were verified by qRT-PCR.
Cell Proliferation, Cell Cycle Assay And Soft-agar Colony Formation
For cell proliferation assay, 2 × 103 cells were seeded into a 96-well plate format. And after 24, 48, 72, 96, or 120 hours, cells were incubated in 10% MTS (Promega) diluted in culture medium at 37 ℃ for 2 hours. And the absorbance at 492 nm was detected using a SpectraMax M5 multimode plate reader (Molecular Devices).
For cell cycle analysis, a total of 1 × 106 cells were harvested, washed with PBS twice, fixed in 70% cold ethanol, incubated with staining solution (100 µg/ml propidium iodide, 50 µg/ml RNase A, 0.1% Triton X-100 in PBS) for 30 min at 37 °C in the dark, and analyzed by flow cytometry.
A 1.5-ml base layer of agar (0.6% agar in DMEM with 10% FBS) was allowed to solidify in a six-well flat-bottomed plate before the addition of 1.5 ml of cell suspensions containing 2,000 cells in 0.3% agar in DMEM with 10% FBS. Colonies were allowed to grow for 14 days at 37 ℃ with 5% CO2 before imaging.
Cell Migration, And Invasion Assays
Migration and invasion assays were performed using a Boyden chamber system with a polycarbonate membrane (8-µm pore size; 24-well plate; Costar). For the invasion assay, the chambers were pre-coated with 50 µl/cm2 of matrigel matrix (BD Biosciences). The cells were re-seeded (2 × 104 cells) in the upper chamber containing serum-free medium. And the lower chamber contained 0.5 ml medium supplemented with 10% FBS. After incubation, cells on the upper surface of each filter were wiped off with a cotton swab. Cells on the lower surface of membrane were fixed with 4% formaldehyde, stained with 0.1% crystal violet, washed with water and air-dried and counted under the microscope.
Transient Transfection
A TWIST1 expression plasmid (pEZ-M13-TWIST1, catalog No.: EX-U1219-M13) and a control vector were purchased from GeneCopoeia, Inc (Guangzhou, China). miRNA-543 inhibitor and negative control were purchased from GenePharma, Inc (Shanghai China). Transfection of plasmids or siRNAs was performed using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions.
TWIST1 Gene 3'UTR Luciferase Reporter Assay
The TWIST1 3’ UTR was PCR amplified from SGC7901 cDNA and cloned into the SacI/Nhe I site of the pGL3 luciferase reporter plasmid (Promega). The primers used were: TWIST1-3’ UTR- forward, GGCGAGCTCGGAGACCTAGATGTCATTGTT; TWIST1-3’ UTR- reverse, CTAGCTAGCCCCTCAGAGGAAGGATGAA. 293T cells were plated at a density of 5 × 104 cells per well in 24-well plate format and allowed to settle for 24 hours. Cells were transfected with pRL-TK renilla plasmid (15 ng/well), pGL-3 luciferase reporter plasmids (150 ng/well), and miR-543 mimic (50 nmol/L) or scramble (50 nmol/L) using the Lipofectamine 2000 reagent (Invitrogen). Luciferase and renilla signals were determined 48 hours after transfection using a Dual Luciferase Reporter Assay Kit (Promega).
Xenograft Tumor Model
Animal tests were approved by the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Animal Care and Use Committee of Sun Yat-Sen University. Female BALB/c (nu/nu) mice 4- to 6-week old were purchased from the animal facility center of Sun Yat-Sen University (Guangzhou, China). SGC7901 cells (3 × 106 cells) transfected with either the vector overexpressing miR-543 or the negative control vector were inoculated subcutaneously into the right anterior flank of nude mice. Five mice were used in each group. The volume of the implanted tumor was measured at every 3 days with a vernier caliper, using the formula: V = L × W2 × π/6; where L is the length, W is the width and V is given in mm3. The mice were sacrificed and the tumors were weighed 3 weeks after inoculation.
Immunoblot Analysis And Immunohistochemistry
Immunoblot analysis was performed as previously described [25] using anti-TWIST1 antibody (1:1000 dilution; Abcam) and anti-GAPDH antibody (1:1000 dilution; Cell Signal Technology).
For the immunohistochemistry (IHC) analysis, the excised tumors were fixed with 4% paraformaldehyde and sectioned into 6-µm sections. Briefly, after deparaffinization, antigen retrieval and quenching of endogenous peroxidase activity, the slides were incubated with the primary antibody (TWIST1, 1:200 dilution, Abcam) overnight at 4 ℃ in a humid chamber. A negative control was obtained by replacing the primary antibody with a normal IgG. Thereafter, slides were incubated with the secondary antibody conjugated to horseradish peroxidase (HRP). Antibody binding was visualized using the DAB + Substrate Chromogen System (DAKO). Finally, sections were counterstained with hematoxylin, dehydrated, cleared, and photographed.
The immunohistochemistry scoring was performed by two independent observers. Unequivocal nuclear staining pattern for TWIST1 was interpreted based on the intensity as negative, weak, moderate and strong. Moderate to strong nuclear staining was considered to be positive reaction. The distribution of TWIST1 was scored as follows: negative (less than 50% of the cells being positive) and positive (where more than 50% of the cells were positive).
Statistics
Statistical analyses were performed utilizing the SPSS 13.0 software. Results are expressed as the mean ± SD (standard deviation). Student’s t-test (two-tailed) was used. A difference was considered significant if the P value was less than 0.05.