Virus, cells and chickens
ALV-J (NX0101 strain) [46] were maintained in our laboratory and titered by TCID50 assays in CEF. The CEF and the chicken B-cells line (DT40 cells) [47] were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, and 1% l-glutamine, in a 5% CO2 incubator at 37 °C. Cells were infected with ALV-J containing 10 − 4 TCID50, it was needed to add 8 µg/mL polybrene when infected chicken B-cells.
The 6-day-old embryos of Leghorn specific-pathogen-free (SPF) chickens (Jinan poultry technology company, China) were injected with ALV-J through the allantoic cavity to establish the infected group (n = 30).The control group (n = 30) was established by injecting DMEM instead of virus. The treatment of virus inoculation, chicken embryos incubation, and virus detection were all followed as our previous description[13].
Proteomics assay and bioinformatics analysis
In order to screen differentially expressed proteins that plays a key role in cell signal transduction under ALV-J infection,protein lysates from ALV-J-infected CEF and normal CEF were collected for proteomic analysis and bioinformatics analysis. The experimental process, iTRAQ labelled LC-MS/MS, and bioinformatics analysis were all followed as our previous description [48].
Confocal laser scanning microscopy
Chicken B-cells were cultured in flask and infected with ALV-J. These cells were maintained for 48 h with DMEM containing 10% neonatal calf serum at 37 °C in a 5% CO2 incubator. The cells were fixed with the ice-cold methanol for 10 min, and blocked with PBS containing 10% FBS for 10 min at room temperature after washed with PBS. The cells were then incubated with the rabbitanti-chicken ALV-J primary antibodies (made in our laboratory, 1:200) and the mouse anti-chicken Lyn primary antibodies (Novus Biotech, Colorado, USA, 1:200) for 2 h at 37 °C, followed by incubation with fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit secondary antibodies and the alexafluor 647 (AF647)-labeled goat anti-mouse secondary antibodies (Bioss, Beijin, China, 1:1000) for 30 min at 37 °C. After staining cell nuclei with 4′, 6-diamidino-2-phenylindole (DAPI), the cells were seeded on glass bottom dish and observed by SP8 CLSM (Leica,Germany).
Quantitative real-time PCR
Total RNA was extracted from CEF cells or chicken B-cells using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, USA). One microgram of total RNA was used as a template to synthesize cDNA using a reverse transcriptase kit (TaKaRa, Shiga, Japan) to generate first-strand cDNA. qPCR was performed by the LightCycler 96 system (Roche, Basel, Switzerland) with the diluted cDNA. The mRNA levels were analyzed using the 2−ΔΔCt method[49].
The primers were as follows: Lyn-F: 5’-TGCGTG CGTGGTTATTATTTC-3’,
Lyn-R: 5’-AATGGTGAGGTCGCTGACTGT-3’;
Fyn-F: 5’-TTGTTGAAGGCAAGCATCAG-3’,
Fyn-R: 5’-GAGGATAGCATCTGCCCTTT-3’;
Syk-F: 5’-G TCTCCATCCACCACACCTTCT-3’,
Syk-R: 5’-ACAAGCAGTCCAAGGCAGTGA-3’.
Western blot
Tissues or cells were collected and then lysed in RIPA lysis buffer (BeyotimeBiotech, Shanghai, China). Proteins from the tissue lysates were separated by polyvinylidenedifluoride (PVDF) membranes electrophoresis. The PVDF membranes were incubated with primary antibodies after being blocked by difco skim milk (Solarbio, Beijing, China). The primary antibodies included mouse anti-chicken Lyn monoclonal antibody (Novus Biotech, Colorado, USA,1:200), rabbit anti-Fyn polyclonal antibody (Jackson, Westgrove, USA,1:800),rabbit anti-NF-κB p65 polyclonal antibody (Bioss, Beijin, China,1:200), and mouse anti-GAPDH-loading control antibody(Bioss, Beijing, China,1:5000).Finally, the membranes were exposed to a chemiluminescence instrument.
Immunohistochemistry
At the age of 14 and 28 days, the bursa of Fabricius from infected chickens and control chickens were sampled, formalin-fixed, paraffin embedded, and sectioned (5-µm thickness) sections for IHC. All chickens were euthanized with sodium pentobarbital before the organs were removed. The perform of IHC test were followed as our previous description.[13]Negative controls were also performed with the same tissues. Primary antibodies include mouse anti-chicken Lyn monoclonal antibodies (Novus Biotech, Colorado, USA,1:200), rabbit anti-phospho-Lyn(Try397)polyclonal antibody (Bioss, Beijing, China,1:200), rabbit anti-phospho-Lyn༈Try507༉polyclonal antibody (Bioss, Beijing, China,1:200), rabbit anti-phospho-Syk༈Tyr525/526༉polyclonal antibody (Bioss, Beijing, China,1:200). Secondary antibodies were horseradish peroxidase-labelled goat anti-mouse/rabbit IgG polymer. Six randomly selected fields of positive expression in each target tissue section were analysed in Image J software to accurately calculate the positive area and the mean optical density.
Flow cytometry for tyrosine phosphorylation
FCM analysis was performed to assess the levels of phosphorylated Lyn protein (Tyr397 or Tyr507) and phosphorylated Syk protein(Tyr525/526) in B-cells. 8 µg/mL polybrene were added into the DMEM medium containing chicken B-cells to improve the infection efficiency of ALV-J, and then the (Southern Biotech, USA, 20 µg/ml), were added to activate chicken B-cells in logarithmic growth phase. Chicken B-cells were harvested in 2, 5, 10, 30 minutes after stimulation by anti-IgM antibody, and fixed in 100% ice-cold methanol solution. Then these chicken B-cells were divided into three groups and respectively labeled with rabbit anti-phospo-Lyn (Tyr397)-FITC polyclonal antibody(Bioss, Beijing, China,1:200), rabbit anti-phospo-Lyn (Tyr507)-FITC polyclonal antibody(Bioss, Beijing, China,1:200), rabbit anti-phospo-Syk (Tyr525/526) -FITC polyclonal antibody(Bioss, Beijing, China,1:200), incubated at 4 °C in dark for 30 min, washed with PBS buffer and analyzed with BD flow cytometer (BD Biosciences,USA). The same experiment was repeated three times, and isotype control antibodies were also used. Data were analysed using FlowJo (TreeStar) software.
Short-hairpin RNA (shRNA) interference
The pgpu6 / GFP / Neo shRNA interference expression vector (three segments: Lyn-chicken-544: gcagttattctcttctgtcatcatcataa; Lyn-chicken-944: gcttcagcatgaagctagt; Lyn-chicken-1345: ggattctcctgtatatgaaaaatcg) targeted Lyn was constructed and then transfected into chicken B-cellsaccordance with the manufacturer’s instructions. The transfection efficiency was observed by fluorescence microscope and cell growth after transfection with shLyn vector was determined by cell counting kit-8 (CCK-8) test. The Lyn expression after transfection was detected by WB. Then the Syk tyrosine phosphorylation was analysed by FCM as mentioned above.
Calcium mobilization measurement
For recording BCR-induced Ca2+ flux, 106 chicken B-cells were loaded with 2.5 µL Fluo4-AM (Molecular Probes) in 200 µL hanks balanced salt solution containing 1% FBS and at 37 °C for 25 min. These chicken B-cellswere washed with PBS buffer saline for three times, and then kept it at 37 °C. The intracellular calcium basal level was detected by FCM for one minute. Then, the anti-chicken IgM(Southern Biotech, USA, 2 µg/ml) was added to stimulate these chicken B-cells.The fluorescence of Fluo-4 at 516 nmwas continuously measured by the flow cytometer to determine the change of intracellular Ca2+ flux.
Statistical analysis
Multiple sets of data comparisons were measured using one-way analysis of variance (ANOVA). The unpaired t-test was used when two groups were compared. The results were accepted as significantly different when p ≤ 0.05, p ≤ 0.01, or p ≤ 0.001. Analysis and plotting of data were performed using GraphPad Prism 6.0 and are expressed as the means ± SEM.