Method Article
Library Preparation for small RNA sequencing using 4N adapters: In house 4N Protocol A
https://doi.org/10.1038/protex.2018.049
This work is licensed under a CC BY-NC 3.0 License
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted
You are reading this latest protocol version
This protocol describes a library preparation method for sequencing small RNA. The method uses degenerate adapters to alleviate the problem of bias in the ligation steps during small RNA library preparation, and it optimizes several other parameters to make it appropriate for use specifically with plasma RNA.
small RNA sequencing
4N adapters
small RNA library preparation
extracellular RNA
exRNA
ERCC
Extracellular RNAs (exRNAs) have been identified in every biofluid that has been tested. In biofluids, they have been found in extracellular vesicles, ribonucleoprotein complexes, and lipoprotein complexes. ExRNAs are of considerable interest because they can serve as signaling molecules between cells, they have the potential to serve as biomarkers for prediction and diagnosis of disease, and exRNAs or the extracellular particles that carry them might be used for therapeutic purposes.
The Extracellular RNA Communication Consortium (ERCC) is a group of laboratories funded by the U.S. National Institutes of Health. One goal of the ERCC is to develop robust and standardized methods for collecting and processing of biofluids, separating different types of exRNA-containing particles, and isolating and analyzing exRNAs. The "Reference Profiles group":http://exrna.org/referenceprofiles/ within the consortium is tasked with collecting reliable profiles of the spectrum of extracellular RNAs found in healthy individuals. These reference profiles will serve as benchmarks for comparison with the exRNA profiles from patients with disease. The present protocol for small RNA library preparation was developed by the ERCC Reference Profiles group for use with RNA isolated from human plasma.
Key elements of this small RNA library preparation method include the use of 4 random nucleotides on the end of the adapters ligated to the small RNAs of interest, the use of higher than usual adapter concentrations, and the use of increased amounts of polyethylene glycol (PEG) in the ligation steps. Small RNA library preparation methods that lack such degenerate adapters have been found to exhibit significant bias in the representation of different RNA sequences.1-4 The use of random adapters is designed to alleviate that problem. The use of high adapter concentrations and macromolecular crowding agents such as PEG reduces bias by driving the ligation reactions toward completion. It should be noted that the use of improved ligation conditions and increased adapter concentrations also results in the formation of more adapter dimers, so purification of desired ligation products from such unwanted side products by size fractionation is essential in this protocol.
PCR amplification Small RNA libraries may require 10-20 cycles of PCR amplification depending on the type and amount of input. It has been shown that increased amplification does not significantly affect library bias.1,5 Increased number of PCR cycles will, however, increase the amount of adapter dimers that must be separated from the library. Typically, a single PCR and gel purification step is sufficient to remove most of the adapter dimer products from insert-containing PCR products.
Size selection Because of the large excess of adapter dimers in low-input small RNA libraries, electrophoretic purification of PCR products is often necessary. This can be done using either acrylamide or agarose gels, as long as the gel can sufficiently resolve the insert-containing fragments (==150bp) from the adapter dimer fragments (==125bp).
A full list of the protocols developed by the ERCC is available at the "exRNA Portal":http://exrna.org/resources/protocols/, the ERCC’s website.
This protocol is one of four protocols relating to a 2018 Nature Biotechnology paper.
Library Preparation for small RNA sequencing using 4N adapters: In house 4N Protocol A
"10.1038/protex.2018.049":http://dx.doi.org/10.1038/protex.2018.049
Library Preparation for small RNA sequencing using 4N adapters: In house 4N Protocol B
"10.1038/protex.2018.050":http://dx.doi.org/10.1038/protex.2018.050
Library Preparation for small RNA sequencing using 4N adapters: In house 4N Protocol C
"10.1038/protex.2018.081":http://dx.doi.org/10.1038/protex.2018.081/
Modified TruSeq Small RNA Library Prep using Randomized 4N Adapters: In house 4N Protocol D
"10.1038/protex.2018.052":http://dx.doi.org/10.1038/protex.2018.052
Oligonucleotide sequences1
5’ adapter (desalted) – 5’ rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrCr(N:25252525)r(N)r(N)r(N)
3’ adapter (HPLC purification) – 5’ /5rApp/(N:25252525)(N)(N)(N)TGGAATTCTCGGGTGCCAAGG/3ddC/
RT primer (desalted) – 5’ GCCTTGGCACCCGAGAATTCCA
RP1 PCR primer (HPLC Purification) – same as Illumina RP1 PCR primer
Indexed PCR primers RPI1-RPI48 (HPLC Purification) – same as Illumina RPI1-RPI48 primers
Reagents for 3’ Ligation
T4 RNA ligase 2 truncated KQ (NEB M0373)
10X T4 RNA ligase reaction buffer (included with T4 RNA ligase)
50% PEG 8000 (included with T4 RNA ligase)
RNAseOut RNAse inhibitor (Invitrogen 10777-019)
Strip tubes (Axygen PCR-0208-CP-C or equivalent)
Reagents for adapter depletion
E. coli single-stranded DNA binding protein (SSB) (Promega M3011)
5’ deadenylase (NEB M0331)
RecJf (NEB M0264)
Reagents for 5’ Ligation
10mM ATP (NEB P0756)
T4 RNA ligase 1 (NEB M0204)
Reagents for Reverse Transcription
Strip tubes (Axygen PCR-0208-CP-C or equivalent)
Superscript III (Invitrogen 18080-044)
5x First strand buffer (included with Superscript III)
0.1M DTT (included with Superscript III)
25mM dNTP mix, diluted 1:2 before use (Thermo Scientific R1121)
RNAseOut RNAse inhibitor (Invitrogen 10777-019)
RiboShredder RNAse blend (Epicentre RS12500)
Reagents for PCR Amplification
NEBNext Ultra II Q5 PCR master mix (NEB M0544) or other high fidelity PCR master mix
DNA Clean and Concentrator 5 columns (Zymo D4004)
Reagents for Gel Purification
5X Novex TBE sample loading buffer (Invitrogen LC6678)
10-well 6% Novex TBE gel (Invitrogen EC6265BOX)
Sybr Gold (Invitrogen S-11494)
Qiagen EB buffer (Qiagen 19086)
SpinX column (Corning 8163)
Reagents for Library Validation
Equipment for Ligations and Reverse Transcription
Vacuum concentrator
Thermal cycler
Equipment for PCR Amplification
Equipment for Gel Purification
Thermomixer
Electrophoresis chamber
Equipment for Library Validation
This protocol is optimized for plasma libraries starting with ~100 μL of plasma.2
Resuspend the 5' adapter at 25 μM.
Resuspend the 3' adapter at 10 μM.
Resuspend the RT primer at 10 μM.
Resuspend the RP1 PCR primer and the indexed PCR primers (RPI1-48) at 20 μM.
Make dried PEG strip tubes. These create a high PEG concentration in a small volume for the 3’ ligation.
Batches of dried PEG PCR tubes can be made as follows. Add 3 μL of 50% PEG 8000 (supplied with NEB RNA ligases) into each strip tube and dry in the speedvac using low heat (37°C). This may take 1-2 hours depending on the speedvac. Once dry, the PEG will appear as a white, flaky pellet in the bottom of the tube. Cap the tubes and store desiccated at room temperature. Note that the 50% PEG solution is very viscous, so care must be taken when pipetting. Diluting the 50% PEG to 25% and aliquoting larger volumes may improve pipetting accuracy. Positive displacement pipettes may also be helpful.
3’ Ligation
To each strip tube, add:
x μL RNA
1 μL Adenylated 3’ adapter (10 μM stock concentration)
5-x μL Water
6 μL Total
The dried PEG in the strip tube will take up about 1 μL in the reaction after resuspension.
To each tube containing 7 μL of denatured RNA and adapter, add:
1 μL 10X T4 RNA ligase reaction buffer
1 μL RNAseOut RNAse inhibitor
1 μL T4 RNA ligase 2 truncated KQ
3 μL Total
5’ ligation
In a separate tube, add 1 μL of 5’ adapter (25 μM stock concentration) per ligation and denature at 70°C for 2 minutes, then snap cool on ice.
To the tube of denatured 5’ adapter, add (per ligation):
1 μL 10mM ATP
1 μL T4 RNA ligase 1
Reverse transcription (RT)
To a new tube, add:
1 μL RT primer (10 μM stock concentration)
6 μL Ligated RNA (Store leftover ligated RNA at -70°C.)
7 μL Total
Add:
2 μL 5x First strand buffer
0.5 μL 12.5 mM dNTP mix
1 μL DTT
1 μL RNAseOut
1 μL Superscript III
5.5 μL Total
Add to 7 μL denatured RNA/primer for 12.5 μL total RT reaction.
PCR amplification
25 μL PCR master mix (NEBNext Ultra II Q5 or equivalent)
2 μL Illumina RP1
2 μL Illumina RPI1-48 reverse index primer
8 μL water
13 μL cDNA
50 μL Total
98°C 30 sec. 1X
-------------------
98°C 10 sec.
60°C 30 sec. 15-20X
65°C 35 sec.
-------------------
65°C 2 min. 1X
Gel purification
Oligonucleotide sequences © 2016 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited.
This protocol is optimized for plasma libraries starting with ~100 μL of plasma. Libraries with more starting material can probably tolerate higher adapter concentration and higher PEG concentration. Libraries with less starting material may need reduced adapter or PEG concentration. Caution: Differential expression analysis, i.e. comparison of RNA levels across samples, should not be done between data sets from libraries prepared using different PEG or adaptor concentrations. Relative read numbers are affected by these parameters.
Incubating the reverse transcription reaction with RiboShredder RNAse blend might not be necessary.
Jayaprakash AD, Jabado O, Brown BD, Sachidanandam R. 2011. Identification and remediation of biases in the activity of RNA ligases in small-RNA deep sequencing. Nucleic Acids Research 39: e141.
Sorefan K, Pais H, Hall AE, Kozomara A, Griffiths-Jones S, Moulton V, Dalmay T. 2012. Reducing ligation bias of small RNAs in libraries for next generation sequencing. Silence 3: 4.
Zhang Z, Lee JE, Riemondy K, Anderson EM, Yi R. 2013. High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing. Genome Biology 14: R109.
Zhuang F, Fuchs RT, Sun Z, Zheng Y, Robb GB. 2012. Structural bias in T4 RNA ligase-mediated 3'-adapter ligation. Nucleic Acids Research 40: e54.
Hafner M, Renwick N, Brown M, et al. 2011. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA 17:1697-1712.
The authors declare no competing financial interests.
This protocol has been posted on Protocol Exchange, an open repository of community-contributed protocols sponsored by Nature Portfolio. These protocols are posted directly on the Protocol Exchange by authors and are made freely available to the scientific community for use and comment.
posted
You are reading this latest protocol version