Clinical samples
Five normal brain tissues and twenty GBM samples were collected from The department of Neurosurgery, Lianyungang Clinical College of Nanjing Medical University. Samples were surgically resected and frozen immediately in liquid nitrogen for further study. The use of clinical samples was approved by Lianyungang Clinical College of Nanjing Medical University.
Cell culture
The human glioma cell lines, U251 and T98G, were purchased from ATCC. Cells were maintained using DMEM supplemented with 10% FBS (Fetal Bovine Serum), 100 μg/ml penicillin, and 100 μg/ml streptomycin in 37℃. Cells were thawed fresh every 2 months.
Cell transfection
Polymerase chain reaction (PCR)-amplified full length or truncated human PGK1 was cloned into pcDNA3.1/hygro(+)-Flag. The authenticity of all the constructs was confirmed by DNA sequencing. LipofectamineTM 2000 reagent was used for plasmids transfection. shRNA targeting NEAT1 was purchased from Ribobio (China) and transfected into GBM cells according to the manufacturer’s instruction.
RNA extraction and qRT-PCR analysis
Total RNA from U251 and T98G cells was extracted using TRIzol reagent (Invitrogen, CA) as previously described[13]. qRT-PCR was performed using SYBR Green Premix Ex Taq (TaKaRa) according to the manufacturer’s recommendations. The sequence information of NEAT1 primers used in this study was shown below.
Forward: CCAGTTTTCCGAGAACCAAA
Reversed: ATGCTGATCTGCTGCGTATG
Protein extraction and western blot analysis
Protein samples preparation and western blot analysis were performed as previously described[13]. Antibodies against CDK2 (#18048, Cell Signaling Technology), CDK4 (#12790, Cell Signaling Technology), CDK6 (#13331, Cell Signaling Technology), PGK1 (#68540, Cell Signaling Technology), Flag (F9291, Sigmaaldrich), HA (#3724, Cell Signaling Technology), and GAPDH (#5174, Cell Signaling Technology) were used in this study.
CCK-8 assays
CCK-8 assays were performed to evaluate cell growth. Briefly, 2000 transfected U251 and T98G cells were seeded into a 96-well plates. CCK-8 reagent was added at indicated time and incubated for 1 h at 37 ℃. The absorbance was detected at 450 nm.
Colony formation assays
Colony formation assays were performed to evaluate cell growth. Briefly, 400 transfected U251 and T98G cells were seeded into a 6-well plate. And cells were maintained until colonies formed. Colonies were then fixed by paraformaldehyde and stained using crystal violet. The colonies were then calculated for further analysis.
Extracellular acidification rate analysis
The XF Glycolysis Stress Test kit was used for the ECAR assay. Briefly, 1 x 104 transfected U251 and T98G cells were seeded into the Seahorse SF 96 cell culture microplates. 10 mM glucose, 1 um oligomycin, and 75 mM 2-DG were added to the cell medium at indicated time. Next, Seahorse SF-96 Wave software was used to analyze the results. ECAR was presented in mpH/min.
Measurement of intracellular Lactate levels
The accumulation of lactate in transfected glioma cells was measured using lactate assay kit II (Sigma Aldrich, MAK065). Briefly, glioma cells were homogenized and centrifuged at 13000 g for 10 min. The supernatant was collected and deproteinized using a 10 kDa MWCO spin filter to remove lactate dehydrogenase. Reaction Mixes were prepared according to manufacture. Add 50 μl mix to a 96-well plate and incubated the reaction for 30 min at room temperature. Measure the absorbance at 450 nm.
RNA pulldown assay
Biotin-labeled RNA NEAT1 was transcribed in vitro using the T7 High Yield RNA Transcription Kit (Vazyme) and PierceTM RNA 3’ End Desthiobiotinylation Kit (Thermo Fisher). Next, PierceTM Magnetic RNA-protein Pull-Down Kit (Thermo Fisher) was used to obtain the RNA-protein binding mixture. Mass spectrometry was performed to identify target proteins.
RNA immunoprecipitation (RIP) assay
Magna RIP RNA Binding Protein Immunoprecipitation Kit (Millipore) was used for RIP assays. Briefly, whole cell lysis was extracted from 1 x 105 U251 and T98G cells. The protease inhibitor cocktail and RNase inhibitor were added into the cell lysis for 5 min. Meanwhile, magnetic beads were incubated with IgG or Flag antibodies for half an hour at room temperature. After centrifugating at 1000 g for 10 min, the supernatant of cell lysis was incubated with coated beads and incubated at 4 ℃ overnight. At last, the purified RNA was quantified by qRT-PCR.
Animal study
The animal manipulations were approved by Animal Core Facility of Nanjing Medical University. 1 x 106 U251 cells, which were transfected with luciferase reporter, were suspended in 10 ul of DMEM, and intracranially injected into nude mice (female, 6-week-old). The tumor growth was monitored by bioluminescence imaging system at indicated time. At the end, the tumors from brains were fixed and embed using paraffin for further IHC analysis.
Immunohistochemistry analysis
Paraffin-embedded clinical human and mice samples were sliced into 4 mm slides followed by dewaxing, rehydration. Antibodies against ki-67 (#9027, Cell Signaling Technology)and PGK1 (ab233135, abcam) were incubated with tissues overnight at 4 ℃. The protein expression was detected using DAB (Gene Tech). The IHC score was judged by two independent pathologists. The following proportion scores were assigned: 0, 1, 2, 3, 4, and 5 if 0%, 0%–1%, 2%–10%, 11%–30%, 31%–70%, and 71%–100% of the tumor cells exhibited positive staining, respectively. Also, the staining intensity was rated on a scale of 0 to 3: 0, negative; 1, weak; 2, moderate; and 3, strong. A total score was obtained by adding the proportion score and intensity score.
Statistic analysis
Two-tailed unpaired Student’s t-test was used for statistical analysis. All experiments were performed for three time and all data represent the mean ± SD. p < 0.05 was considered as statistically significant.