Immunohistochemistry(IHC)
The PC tissue microarray (hpan-ade120sur-01) consisted of 115 points in 60 cases were bought from Shanghai core super Biotechnology Co., Ltd.A full description of the prototype IHC assay is provided in the supplementary methods of Akturk G et al.[9]. In brief, the unstained slides of tissue microarray were first baked at 60℃, deparaffinized in xylene, and rehydrated through a series of graded ethanols into distilled water. Antigens in the tissue were unmasked by placing the slides into a steamer withcitrate buffer , the slides were incubated overnight with the primary antibody (human sortilin polyclonal goat IgG antibody, AF3154, R&D Biotechnology) diluted in DAKO Primary Antibody Diluent (2 μg/mL). After rewarming, add the secondary antibody (substance-labeled rabbit anti-goat).Detection of the primary antibody was performed using DAB reagents (horseradish peroxidase polymer, diaminobenzidine chromogen, and diaminobenzidine enhancer), washing with PBS between the incubation steps. The slides were counterstained with hematoxylin, coverslipped and viewed with the aid of a light microscope.
The interpretation is according to TPS[10]. TPS=(Thenumberof viable tumor cells positive for sortilin/total number of viable neoplasti ccells)×100%. 0 points (negative), 1 point (1-25%), 2 points (26%-50%), 3 points (51-75%), 4 points (76%-100%), take the median(90%) as the standard,and score less or equal than 90% was defined as low expression, and more than 90% as high expression.
Cell culture
The pancreatic cancer cells, Capan1 and Bxpc3, are from the Imaging Laboratory of North Sichuan Medical College. Capan1 cells were grown in IMDM (SH30228.01, Hyclone) with 20% FBS. Bxpc3 cells were cultured in RPMI-1640 Medium (SH30809.01, Hyclone), supplemented with 10% fetal bovine serum (11011-8611, Sijiqing, Zhejiang Tianhang Biotechnology Co., Ltd.) at 37℃ in a 5% CO2 incubator.Cells were dissociated with 0.25% Trypsin-EDTA (PYG0015, Boster Biological Technology co.ltd) at 37℃ for 5min and collected by centrifugation at 1000 rpm for 5 min. Cells were resuspended in a new complete medium and placed in an incubator for further culture.
Cell siRNA transfection
The Capan1 and Bxpc3 cells were seeded in 6-well plates at 50% confluence 1 day prior to transfection.We used a ratio of 50 pmol siRNA (SR304211,OriGeneTechnologies) Rfect 10μl(11013, Changzhou Baidai Biotechnology Co., Ltd) to mix them in 500 μl of serum-free medium for 20 min and then the siRNA/Rfect mixture was added to the cells with 2 ml of complete medium overnight. The targets equences for siRNA are siRNA-A: GCAGAGCUAGAUAUAGCAC, siRNA-B: CGCAAGGACAGGGUACAAACUUAGC, siRNA-C: AGACGUAGGAAACUCAAUAUUCUTC. Transfection of cells were performed in triplicate. The transfection effect of sortilin knockdown was evaluated by RT-PCR and verified by western blot.
Reverse Transcription Polymerase Chain Reaction(RT-PCR)
Cells were collected at 24hours (Bxpc3) and 48 hours (Canpan-1) after transfection. The cells in a well of 6-well plate were mixed with 1 mL of TRIzol(DP405-02, Tiangen Biotech (Beijing) Co.,Ltd.). Total RNA was extracted according to the manufacturer’s instructions using a Total RNA Extraction Kit(TR201-100, Beijing Tianmo Technology Development Co., Ltd.). Total RNA concentration and OD value were measured, and reverse transcribed into cDNA by Reverse Transcription Kit (K1622, Thermo Fisher Scientific). The qPCR reactions (20μl final volume) were conducted using the Bestar® SybrGreen qPCR Mastermix (DBI-2043,DBI®Bioscience). See Table I for primer sequence.Reaction conditions for RT-PCR were denaturation for 5 min at 95 ℃, 95 ℃ for 30 sec, 55 ℃ for 30 sec, and 72 ℃ for 40 sec for 35 cycles.2-ΔΔct were used to analyze the results. Each experiment was repeated three times.
Cell scratch test
A marker pen was used to draw an uniform line every 0.5-1 cm at the back of the 6-well plate, with three transverse lines crossed over each well. After 24h transfection, Capan1and Bxpc3 cells were overpaved to 12-well plates.Three horizontal lines were drawn perpendicular to the reference line. The cells were washed three times with PBS and added serum-free medium, at 37°C with 5% CO2 for 24 hours.Samples were taken at t = 0, 12hours.Each result was repeated three times.
CCK8 cell proliferation experiment
Cells were plated on 96 well plates at concentration of 5000 cells/well.The cells were cultured in an incubator at 37°C 5% CO2 for 24 h.CCK8 reagents(boster,China) were prepared in fresh medium (100μl medium containing 10μl CCK8 solutions) and applied to the cells.After cell treatments, the incubation was continued for 2 hours at 37°C 5% CO2.Absorbance was measured at 450/540 nm (Sunrise™ Absorbance Reader).Each result was repeated three times.
Transwell cell invasion experiment
Matrigel (BD Biosciences, Beijing, China) was thawed overnight at 4℃ and then kept on ice.Matrigel was diluted by serum-free medium (1:8 dilution) on ice and added 45μl to transwell chambes for 2 h at 37°C. The transfected cells (20x104) in 100μl were added to the upper chamber of the transwell chamber, and 600 μl of medium containing 20% fetal bovine serum was added to the lower chamber at 37℃ 5%CO2 for 72hours.The lower chamber was washed with PBS for three times, following which a cotton bud was used to remove cells and medium from the upper chambers,fixed with methanol for 15 min, washed with PBS and stained with Giemsa solution (Gibco BRL) for 30 min.The stained cells were photographed with a digital camera. The number of colonies in each well was counted with Image J software.Each result was repeated three times.
Western blot experiment
MIP-3α(10485-H07E, Sino Biological Solution Specialist)[11, 12]was added to the culture medium at a final concentration of 100ng/ml, incubating for 24 h.After 48-72h of transfection, the medium was discarded and 100μl of RIPA lysate (P0013B, Beyotime Biotechnology) was added into each well.After 48 hours transfection, 2μg/ml puromycinwas added into the medium.The primary antibodies MMP9(13667, Cell Signaling Technology), p53(2527, Cell Signaling Technology), NFκB p65(8242, Cell Signaling Technology) are rabbit monoclonal antibodies, and Sortilin (AF3154,R&D Bio-techne brand) is Antigen Affinity-purified Polyclonal Goat IgG. The secondary antibody uses HRP Conjugated AffiniPure Goat Anti-rabbit IgG(BA1054,Boster Biological technology Co., Ltd.) and HRP Conjugated AffiniPure Rabbit Anti-goat IgG(BA1060,Boster Biological technology Co., Ltd.).The test refers to the steps summarized by Sean C Taylor et al. The relative gray scale of the bands was analyzed using Image J software.Each result was repeated three times.
Statistical analysis
Statistical analysis was performed using SPSS23.0 and Graphpad prism7 software.Measurement data was presented as mean±standard deviation (SD).Enumeration data and categorical variables were analyzed using c2 or Fisher's exact tests.The median survival time and the mean survival time were calculated by Kaplan-Meier method. No significant (P>0.05), Statistically significant difference was considered at *:P<0.05,**:P<0.01 ,***:P<0.001 and ****:P<0.0001 between groups.
The Receiver Operating Characteristic (ROC) curve and binary logistic regression were applied to IHC data.