Ethical audit certificates
The human experiment was approved by the ethics committee of The Second Affiliated Hospital of Jiaxing University and complied with the human medical research ethics in Declaration of Helsinki. All subjects signed an informed consent form before registration. The animal experiment procedures were carried out in accordance with the ethical standards of the animal experiment system approved by the Animal Ethics Committee of the Second Affiliated Hospital of Jiaxing University. All measures were taken to minimize the pain of the included animals.
Bioinformatics analysis
Microarray data GSE83521 of GC-related circRNAs was obtained from Gene Expression Omnibus database. The affy package in R software [13] was adopted for pre-processing and normalization of The microarray data. The limma package [14] was utilized to screen differential circRNAs with log2FC >1 or <−1 and p < 0.05 as the criteria, followed by drawing of heat map of the differential circRNAs. The possible regulatory mechanism of circ_0001013 was further predicted by circinteractome database. The target genes of miR-136 were analyzed by miRDB (http://www.mirdb.org/), StarBase (http://starbase.sysu.edu.cn/), microT (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=microT_CDS/), and mirDIP (http://ophid.utoronto.ca/mirDIP/). Differentially expressed gene analysis was performed based on GC samples of TCGA database via GEPIA tool. The jvenn web tool (http://jvenn.toulouse.inra.fr/app/example.html) was utilized to obtain the intersection of analyzed miRNA-target genes and differentially highly expressed genes in GC. The survival curve was analyzed through KMplot tool (http://kmplot.com/).
Construction of vector and detection of circ_0001013 target gene by dual-luciferase reporter assay
The target gene of circ_0001013 was predicted by circinteractome database, and dual-luciferase reporter assay was implemented to investigate whether miR-136 was a direct target gene of circ_0001013. The sequences were obtained in GenBank database (National Center for Biotechnology Information, Bethesda, MD, USA). According to the prediction results, the sequences 3'-untranslated region (UTR) of miR-136 (potential target gene of circ_0001013) was designed. One-step Site-directed Mutagenesis was employed to clone reporter gene plasmid vectors containing miR-136-3'UTR wild type and miR-136-3'UTR mutant type. Overexpression (oe)-circ_0001013 was co-transfected with miR-136-Wt or miR-136-Mut plasmids into cells for 24 hours. After 6 hours of conventional culture in 5% CO2 incubator at 37℃, the new medium was replaced. After 48 hours of continuous culture, the cells were lysed. The 100 μL PLB was added to each well, shaken at low speed for 15 minutes, and set aside at -4℃. Dual-luciferase reporter assay was operated as per the manuals of a dual luciferase reporter gene assy kit (#E1910) from Hangseng Biotechnological Company( Inner Mongolia, China): 100 μL fluorescein assay reagent II was taken in the 1.5 mL EP tube, and a TD20/20 Luminometer (Turner Designs, Sunnyvale, CA) was initiated to predict for 2 seconds. The tube was supplemented with 20 μL cell lysis, mixed completely, and positioned in the Luminometer to determine Firely Luciferase (FLUC). Then the 100 μL Stop&Glo preparation was added to measure Rellia Luciferase (RLUC). The relative luciferase intensity was calculated by RLUC/FLUC. According to RLUC/FLUC, the target sites of miRNA were determined.
Detection of dual luciferase activity
The target genes of miR-136 were analyzed by biological prediction website (http://www.targetscan.org/vert_72/). TWSG1 was confirmed to be the direct target of miR-136 via dual-luciferase reporter assay. The TWSG1 3'UTR gene fragment was cloned into pMIR-reporter. The sequenced luciferase reporter plasmids Wt and Mut were co-transfected with miR-136 into HEK-293T cells respectively. The cells were lysed after transfection for 48 hours. The luciferase activity was estimated by a Dual-Luciferase Reporter Assay System (Promega).
Sample collection
Collected gastric cancer and para-carcinoma tissue from patients who were diagnosed with gastric cancer in the Second Affiliated Hospital of Jiaxing University and received surgical treatment from 2016 to 2019. All patients had not received drug treatment before. A total of 70 pairs of tissue samples were immediately frozen in liquid nitrogen at - 80℃.
Cell transfection
Human 293T cells and human normal gastric epithelial cells RGM-1 were cultured in DMEM (Thermo Fisher Scientific Inc., Waltham, MA, USA). Human GC cell lines MGC-803, SGC-790, MKN45 and HGC-27 were cultured in RPMI 1640 medium. All above medium were supplemented with 10% fetal bovine serum (Gibco, Carlsbad, California, USA), 100 U/mL penicillin, and 100 mg/mL streptomycin. All cells were cultured in a incubator with saturated humidity and 5% CO2 at 37℃.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted by Trizol. The concentration and purity of RNA were determined via spectrophotometry ,the RNA integrity was assesed by agarose gel electrophoresis. miRNA specific complementary DNA was synthesized by a TaqMan MicroRNA reverse transcription kit and the primers from TaqMan MicroRNA Assay. miR-136 expression was measured in the light of the protocols of TaqMan miRNA Assays and standardized by U6. The primers were synthesized by Beijing Genomics Institute (BGI, Beijing, China) (Table 1). The reverse transcription experiment was taken by the directions of EasyScript First-Strand cDNA Synthesis SuperMix (AE301-02, Beijing TransGen Biotech Co., Ltd.). The reaction solution was taken for real-time fluorescent quantitative PCR on a real-time fluorescent quantitative PCR instrument (ABI 7500, ABI, Foster City, CA, USA) in accordance with the instructions of SYBR®Premix Ex TaqTM II kit (Takara, Dalian, China). The 2-ΔΔCt was the relative quantitative expression target gene expression.
Western blot
Cells were lysed with RIPA cell lysis buffer (P0013B, Beyotime, Shanghai, China) encompassing phenylmethylsulfonyl fluoride at the final concentration of 1 mM. The protein was quantified by a Bio-Rad DC Protein Assay kit (EWELL Bio-Technology Co., Ltd., Guangdong, China). Each sample was mixed with sodium dodecyl sulfate buffer and boiled for 10 minutes. The samples were subjected to gel electrophoresis at 80 V for 30 min and 120 V for 90 min. The proteins were electrically imprinted from the gel onto a PVDF membrane at a constant current of 300 mA for 90 min. The membrane was blocked with tris-buffered saline with Tween 20 containing 5% skimmed milk powder and shaken at 37 degrees Celsius for 2 hours. The membrane was probed with primary antibodies (Abcam, Cambridge, UK) to TWSG1 (ab218995, mouse, 1:1000) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ab8245, mouse-anti-human, 1:5000) at 4℃ for 12h, followed by 1-hour re-probing with goat anti-rabbit Immunoglobulin G (ab6721, 1:20000, Abcam) secondary antibody. Next, the sensitized electrogenerated chemiluminescence was applied for development of the blots. The gray value of protein bands was measured by an Image J software (NIH free software, USA).
Scratch test
The cells were cultured in a 6-well plate with 2.5 × 104 cells/cm2. After 24 hours, the medium was sucked off, and a 10 μL sterilized disposable pipette was utilized to make a wound. The cells were washed twice with PBS and then cultured in RPMI 1640 medium containing 10% FBS. The wound healing of cells at 0 hour and 48 hour was observed at the same location. Each group is provided with three auxiliary holes. The migration ability of GC cells was expressed by Migration rate= (scratch width at T48 - scratch width at T0)/ scratch width at T0 × 100%.
Transwell assay
The apical chamber of Transwell (8 μm aperture, Costar, Cambridge, Massachusetts, USA) was coated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). Transfected cells (1 × 104 in 200 µL serum-free medium) were seeded into the upper chamber for invasion detection. The medium encompassing 10% FBS was added to the bottom chamber as a chemical attractant. Cells were incubated at 37 ℃ for 48 hours to detect invasion in a 5% CO2 chamber. After incubation, the cells in the apical chamber were removed by cotton swabs, and on the lower surface were fixed with methanol, stained with 0.1% crystal violet and observed under a microscope (200×, Olympus, Tokyo, Japan).
Flow cytometry
Total 1 × 106 cells in logarithmic phase were fixed with 70% cold ethanol, mixed with 1 mL propidium iodide staining solution (Becton Dickinson, Franklin Lakes, NJ, USA, 50 μg/mL), and then placed in dark for 30 minutes. Cell cycle was determined by a FACS Calibur flow cytometer. The above results were analyzed with professional software ModFit.
Total 1 × 106 cells in logarithmic phase in 1 × Annexin buffer. Cells were double stained with 5 μL Annexin-VFITC (Becton Dickinson) and 1 μL PI in dark for 10 minutes. The mixture was placed in dark for 5 minutes. Cells were suspended with 300 μL of 1 × Annexin buffer. The result was analyzed with flow cytometry.
EdU assay
GC cells in the NC group and the short hairpin RNA (si)-hsa_circ_0001013 group were labeled with EdU. The method was implemented as per the protocols of EdU proliferation detection kit (CA1170, Solarbio, Beijing, China). After removing the supernatant, 100 μL medium containing EdU (30 μmol/L) was added to each well for 12-hour cell incubation. After discarding the medium, cells were fixed with 4% paraformaldehyde for half an hour. After discarding the fixative solution, the cells were mixed with 50 μL of 2 mg/mL glycine for 5 minutes. Then 100 μL Apollo® staining solution was added into cells in dark treatment, followed by nuclear staining with Hoechst33342 (Thermo Fisher Scientific Inc.). ImagePro software was applied for image acquisition and quantitative analysis.
Biotin coupled probe pull-down assay
The biotinylated probe sequence of hsa_circ_0001013 was 5’-FITC- GGACCGAGTCAAGTCAAAGG -3’. About 1 × 107 cells were lysed in lysis buffer and placed with 3 μg biotinylated probe for 2 hours at room temperature. Cell lysates were cultured with streptavidin magnetic beads (Life Technology, Gaithersburg, MD, USA) for 4 hours to pull down the biotin coupled RNA complex. The magnetic beads were washed five times with lysis buffer. The miRNA in complex was extracted with Trizol reagent to used to do real-time quantitative PCR.
Biotin coupled miRNA capture
About 2 × 106 cells were lysed with 50 μm biotinylated miRNA mimics at 50% aggregation state, and the sequence was GCCCTTCATGCTGCCCAG. After transfection for 24 hours, the cells were lysed in lysis buffer. Mixed 50 μL streptavidin beads for 2 h, then added to tubes and pulled down biotin-conjugated RNA complex. The tubes were incubated at low speed (10 r/min) for 4 hours on a rotator. After that the beads were washed several times with lysis buffer, RNA specifically interacting with miRNA was recovered with Trizol LS (Life Technology). The abundance of hsa_circ_0001013 was assessed by RT-qPCR and agarose gel electrophoresis.
Northern blot analysis
The analysis was performed with a Northern blot Kit (Ambion, Company, Austin, TX, USA). In a word, the total RNA was denatured in formaldehyde and electrophoresed in 1% agarose-formaldehyde gel. Then the RNA was transferred to Hybond-N + nylon membrane and hybridized with biotin-labeled DNA probe. Binding RNA was detected using a biotin chromogenic assay kit. Finally, the membrane was analyzed by an Image Lab software (Bio-Rad, Hercules, CA, USA).
Fluorescence In Situ Hybridization
The hsa_circ_0001013 sequence and miR-136 specific probe were adopted for FISH. In short, a cy5-labeled and farm-labeled probe was specifically targeted cirC_0001013 and miRNA, respectively. The nuclei were stained by 4',6-Diamidino-2-Phenylindole. All steps were performed according to the manufacturer's instructions. The image was obtained on a Zeiss LSM880 NLO confocal microscope system (Leica Microsystems, Mannheim, GER).
Mouse xenografts
MGC-803 cells (1 × 107) were subcutaneously injected into the left armpit of BALB/C nude mice (aged 4-6 weeks, weighing 18 g-22 g, 8 mice/group) to establish xenograft mouse model. After the tumor volume grew to 100 mm3, si-circ_0001013 alone, miR-136 alone or both were injected into the tumors of mice every two days for two weeks. The tumor volume was measured every other day according to the formula V = (W2 × L)/2. All mice were euthanized by CO2 and weighed.
Immunohistochemistry
The specimens were fixed with 10% formaldehyde and embedded in paraffin, and successively cut into 4 μm slices. The slices were dried and dewaxed with xylene, then dehydrated with alcohol. The sections were immersed in 3% methanol H2O2 for half an hour at 37℃. The sections were put into 0.01 M citrate buffer and boiled at 95℃ for 20 minutes, and cooled to room temperature. Normal goat serum blocking solution was dripped onto the sections for 10-minute incubation at 37℃. The sections were incubated with primary antibodies to TWSG1 (ab57552, rabbit anti-human, 1:200), Ki-67 (ab156956, mouse, 1:150), matrix metalloproteinase 9 (MMP9, ab38898, rabbit, 1:500) and CD34 (ab81289, rabbit, 1:2500) at 4℃ overnight. Afterwards, the corresponding biotin-labeled goat anti-rabbit secondary antibody was added for 10-minute incubation at room temperature.The slices were incubated in Streptomyces ovalbumin working solution labeled with horseradish peroxidase (S-A/HRP) for 10 min at room temperature. After that, the slices were stained with diaminobenzidine for 8 minutes in a dark room at room temperature. Then the hematoxylin stained sections were dehydrated, cleared, sealed and observed under an optical microscope. A Nikon image analysis software from Japan was employed to count the positive cells. The number of positive cells was calculated in 3 equal area non-repeated fields in each section (200×). Criteria for judging immunohistochemical staining results: ABCF2 (positive staining was more than 25% of the cells), and obvious brown or brownish yellow granules appeared in the cytoplasm.
Statistical analysis
SPSS 26.0 (IBM Corp. Armonk, NY, USA) was adopted for statistical analysis. P < 0.05 indicated statistically significant difference. The measurement data were summarized as mean ± standard deviation. The T-test was used to compare the experimental groups. One-way analysis of variance (ANOVA) was applied for comparison among multiple groups, while repeated measurement ANOVA was use to analyze the data at different time points, followed by Tukey's post-hoc test. Pearson correlation was conducted to analyze the relationship between the two indexes. Kaplan-Meier method was utilized to analyze the survival rate. Log-rank test was performed for univariate analysis.