Removal of mitochondria from oocytes and embryos
To demonstrate that mitochondrial clearance was effective, we first attempted mitochondrial removal with 100 mouse oocytes. According to the methods (Figure 1A) described above, 100 oocytes without zona pellucida were transferred into lysis buffer above the filter membrane. After lysis and centrifugation, the mixture above the filter membrane and the mixture below the filter membrane were collected for DNA extraction. PCR was then performed to detect the efficiency of mitochondrial clearance. Cxcr3 (F: CGTGCACTATGCTCAGATATCTGTC; R: CCACAGGATTTCAGCCTGAACTTTG) was chosen to represent the nucleus (Nu), and the mitochondrial marker gene ND2 (F: CAACCATTTGCAGACGCCAT; R: TTGGGCTACGGCTCGTAAAG) was used to represent the mitochondria (Mt). The agarose gel electrophoresis results (Figure 1B) showed that both the nucleus and mitochondria were present in the upper mixture, whereas only the mitochondria were present in the mixture below. This result demonstrates that part of the mitochondria could be filtered out, but the nucleus could not pass through the filter membrane. To further test the efficiency of this method to remove mitochondria, we sequenced 50 pig oocytes. Before mitochondrial clearance, the proportion of non-nuclear DNA was as high as 78.61%, whereas the proportion of nuclear DNA was only 21.93% (Figure 1C). After mitochondrial clearance, the proportion of non-nuclear DNA was reduced to 27.51%, whereas the proportion of nuclear DNA was increased to 72.49%. Figure 1D shows the ratio of nuclear DNA and non-nuclear DNA in the final samples (GV1: Nucleus: 49.72%, Non-nucleus: 50.28%; GV2: Nucleus: 72.83%, Non-nucleus: 27.17%; PA1: Nucleus: 73.90%, Non-nucleus: 26.10%; PA2: Nucleus: 61.21%, Non-nucleus: 38.79%; SCNT1: Nucleus: 44.51%, Non-nucleus: 55.49%; and SCNT2: Nucleus: 62.37%, Non-nucleus: 37.63%). Thus, mitochondria were effectively removed from oocytes and embryos.
Accessible chromatin landscape during an early stage of embryo reprogramming
A total of 50 GV oocytes, 50 PA embryos, and 50 SCNT embryos were collected for ATAC-seq analysis, and two replicates were performed for each group. Figure 2A shows the randomly selected IGV browser view, which confirmed that the repeatability between replicates was satisfactory. To study the dynamic changes in the accessibility of chromatin sites at an early stage of embryo reprogramming, our data were also analyzed along with the ATAC-seq data from PEF (unpubl. data). First, we counted the average number of peaks of replicated samples in each group; the results are shown in Figure 2B. A total of 11152 peaks were enriched in PA, 3710 peaks in SCNT, 64634 peaks in GV, and 68019 peaks in PEF. These results suggested that fewer accessible regions were present in PA and SCNT embryos compared with GV oocytes and PEF. Next, we calculated the coverage ratio of peaks in the genome (Figure 2C) and found that PEF had the highest coverage ratio, whereas PA and SCNT had much lower ratios than PEF and GV. These results indicated that low levels of chromatin accessibility and expression of the genome were present in embryos 10 h after parthenogenetic activation and 10 h after somatic cell nuclear transfer.
Dynamic changes in chromatin accessibility around transcription start sites (TSSs)
To explore changes in chromatin accessibility during the somatic cell reprogramming of genes with different expression levels, we downloaded PEF RNA-seq data (accession number: GSM595679) from the NCBI (National Center for Biotechnology Information) database. A total of 24322 genes were divided into three categories based on their level of expression as indicated by the RNA-seq data: top 5% highest genes (1217 genes), silent genes (8229 genes), and other genes (14875 genes). We then analyzed the chromatin accessibility near the TSS of these three types of genes and used deptools for visual drawings. The results are shown in Figure 3. For the top 5% highest genes, there was a strong enrichment signal near the TSS in PEF cells, but there was no obvious enrichment signal near the TSS in SCNT, PA, and GV (Figure 3A). For silent genes, the enrichment signal peaks near the TSS were significantly reduced in PEF cells, but there were no obvious enrichment signal peaks near the TSS in SCNT, PA, and GV (Figure 3B). Other types of genes also had enrichment peaks near the TSS in PEF cells, but the enrichment level was not as high as that observed in the 5% highest genes. Other types of genes had enrichment peaks near the TSS in SCNT, PA, and GV, but they were not typical enrichment peaks of ATAC-seq (Figure 3C). Thus, the chromatin of the highly expressed PEF gene had strong accessibility near the TSS region in PEF cells, but these accessible sites were inaccessible during embryo reprogramming.
Dynamic changes in X chromatin accessibility during embryo reprogramming
Given that the X chromosome experienced a large change during the early stage of reprogramming[25, 26], we analyzed the dynamic changes in X chromatin accessibility near the TSS during somatic cell reprogramming. Figure 4 shows the X chromosome accessibility near the TTS in PEF, SNCT, PA, and GV samples. We found that there was a strong enrichment signal near the TSS region in PEF cells, but no obvious enrichment signal was present in GV, PA, and SCNT. This finding suggested that X chromatin had high accessibility in PEF cells but was tightly structured in oocytes and embryos and had no transcriptional activity.
Distribution of chromatin accessibility sites in gene functional areas
Although the chromatin in the embryo was relatively tight, some accessibility sites could still be detected. To further explore the roles of these accessibility sites, we next calculated the distribution of chromatin accessibility sites in gene functional areas. In PEF, the distribution of accessible chromatin in the promoter area accounted for 8.99% of the functional gene area, 5′ UTR accounted for 3.05%, and the exon area accounted for 7.22% (Figure 5A). However, the proportion of accessible chromatin in the promoter region was decreased in SCNT, PA, and GV (Figure 5B, C, D), which was 3.14%, 3.42%, and 3.24%, respectively. The proportion of accessible chromatin in the 5′ UTR in the promoter region was also decreased, which was 0.43%, 0.54%, and 0.59% in SCNT, PA, and GV, respectively. The proportion of accessible chromatin in the exon region was also decreased to 4.46%, 4.49%, and 4.63% in SCNT, PA, and GV, respectively. Moreover, we also found that the proportion of chromatin open sites in the intergenic region was increased to 58.15%, 52.98%, and 46.63% in SCNT, PA, and GV respectively (Figure 5B, C, D), whereas the proportion was only 38.57% in PEF (Figure 5A). Thus, the ratio of chromatin accessibility sites decreased in gene regions but increased in intergenic regions during an early stage of reprogramming.
The molecular function of accessible chromatin sites
We suspect that the molecular function of the cell changes as highly differentiated oocytes change to pluripotent embryos. To further characterize the role of accessible chromatin sites in oocytes and embryos, we performed gene ontology (GO) enrichment analysis on GV oocytes, PA embryos, and SCNT embryos and focused on the molecular function (MF). The top 10 results are shown in Figure 6. According to the GO annotation, MF terms in GV oocytes included chromatin binding, actin binding, cadherin binding, cholesterol binding, transforming growth factor beta receptor binding, and 3',5'-cyclic-nucleotide phosphodiesterase (PDE) activity. MF terms in PA oocytes primarily included PDE activity, transcription coregulator activity, translation regulator activity, collagen binding, transcription factor binding, and SMAD binding. MF terms for SCNT primarily included PDE activity, translation regulator activity, translation regulator activity, collagen binding, SMAD binding, and protein-containing complex binding. Translation regulator activity and SMAD binding were recovered in both PA and SNCT embryos, and PDE activity was recovered in both oocytes and embryos.
GO analysis of different peaks at an early stage of embryo reprogramming
To investigate the biological function of chromatin accessibility dynamics during somatic cell reprogramming, the different peaks between SCNT and PEF were analyzed for GO enrichment. Here, we compared PEF1 with SCNT because PEF1 was from the same cell line and the same generation of SCNT nuclear donor cells, thereby minimizing the possible effects caused by differences in cell origin and generation. Figure 7 shows the results of the GO enrichment analysis including the biological process (BP) category, cellular component (CC) category, and molecular function (MF) category. The top 10 terms are shown for each category (Figure 7). BP terms indicated that the different accessible chromatin sites between SCNT and PEF were involved in histone modification, blastocyst formation, and covalent chromatin modification. CC terms indicated involvement with the transferase complex, transcriptional repressor complex, and transcription factor complex. MF terms indicated involvement with DNA-binding transcription factor activity, transcription coregulator activity, transcription factor binding, and histone binding. Thus, changes in chromatin accessibility were primarily related to transcriptional activity and histone modification at an early stage of embryo reprogramming.