Cross Talk Between Down Regulation of Steroidogenic Genes Expression, Oxidative and Apoptotic Biomarkers in Testes Induced by Administration of Tramadol and Boldenone and Their Combination in Male Albino Rats

doi:10.21203/rs.3.rs-1024953/v1

Background

The testis is the male reproductive gland or gonad having two vital functions - to produce both sperm and androgens, primarily testosterone.

Purpose

The study aimed to investigate the effect of tramadol and boldenone injected alone or in combinatio for 2 months in rats on testicular function.

Methods

Group 1; normal control, Group 2; tramadol Hcl (TRAM) (20 mg/kg bwt.) (i.p). Group 3; boldenone undecylenate (BOLD) (5 mg/kg bwt) (i.m). Group 4; combination of TRAM (20 mg/kg bwt.) and BOLD (5 mg/kg), respectively for 2 months.

Results

TRAM and BOLD alone and in combination rats showed deteriorated testicular functions, lowered serum steroid levels (FSH, LH and testesterone), elevation in oxidative biomarkers (MDA & NO) and reduction in GSH and SOD, downregulation of StaR and HSD17B3 as well as assessment of testicular histopathological using H&E staining, PAS stain for histochemical assessment of polysaccharides and glycoproteins in the testes and Masson trichrome stain to assess the changes in the collagen fibers.

Conclusion

The study illuminated the hazard of administration of these drugs for a long period as well as the prominent deleterious effects reported on concurrent use of both drugs.

Clinical Pharmacology

Tramadol

Boldenone

Infertility

Steroids

StaR

HSD17B3

Testes

The testis is the male reproductive gland or gonad having two vital functions - to produce both sperm and androgens, primarily testosterone. Testosterone enhances the arising of the distinctive male phenotype as well as the production of sperms. This biological function is under the control of luteinizing hormone (LH) and follicle-stimulating hormone (FSH) released from the anterior lobe of the pituitary gland. LH acts on the Leydig cells to enhance testosterone production while FSH targets the Sertoli cells to enhance the production of androgen-binding protein to which the testosterone will bind and localized in high concentrations near the sperm helping normal spermatogenesis (Oduwole et al., 2018). Leydig cells are interstitial testicular cells where the steroids are synthesized. The steroid biosynthetic pathways are initiated by the precursor; cholesterol. After stimulating the Leydig cell by LH, the cholesterol is mobilized to the inner mitochondrial membrane utilizing steroidogenic acute regulatory protein (StAR) which is encoded by the StAR gene (Stocco, 2001). Inside the inner mitochondrial membrane, the cholesterol will be metabolized by cytochrome P450 to pregnanolone, then the pregnanolone will diffuse out of the mitochondria to the smooth endoplasmic reticulum where it is converted to progesterone by 3β-hydroxysteroid dehydrogenase 1 (HSD3B1, encoded by Hsd3b1 gene). Finally, the progesterone will be converted into testosterone through cytochrome P450 17α-hydroxylase/C17–20 lyase (CYP17A1, encoded by Cyp17a1) and 17β-hydroxysteroid dehydrogenase isoform 3 (HSD17B3, encoded by Hsd17b3 gene) (Ge & Hardy, 2007).

Tramadol is a centrally acting analgesic used in the treatment of moderate acute or chronic pain but it is believed to be only a weak µ- receptor agonist and later on, its predominant mechanism of action showed to be based on blockade of serotonin reuptake as well as stimulation of D2 receptor which results in increased activity of dopamine (Aminiahidashti et al., 2016). This effect endorsed the tramadol to be abused in the Egyptian community which may, unfortunately, develops drug tolerance after prolonged administration of tramadol (Fawzi, 2011). Besides, tramadol is used as an effective form of treatment for mild to severe premature ejaculation at therapeutic doses (Bar-Or et al., 2012). Generally, endogenous and exogenous opioids, modulate the gonadotropin-releasing hormone by targeting the opioid receptors in the hypothalamus and so reducing the LH and FSH release that have a direct effect on testosterone production in testes (El Sawy & Malak, 2015).

Boldenone is a well-known anabolic androgenic steroid (AAS) that is administered by bodybuilders and athletes to develop their physical and muscular performance. This effect takes place by enhancing protein anabolism and reducing protein catabolism in addition to water, nitrogen, and electrolyte retention (Oda & El-Ashmawy, 2012). Generally, anabolic androgenic steroids develop cardiovascular system dysfunction after prolonged use (Sharma et al., 2013). Endocrine impairment has also been reported via triggering negative feedback on the hypothalamic-pituitary axis leading to inhibition of LH and FSH(Dohle et al., 2003) (Dohle et al 2003). Testicular atrophy and gynecomastia are commonly reported after the administration of AAS (Coward et al., 2013).

Nowadays the use of opioids and AAS are noticeably increasing which may lead to severe damage to the testes as well as infertility in males if they are administered in combination. In the current study, the effect of chronic administration of tramadol and boldenone alone or in combination for 2 consecutive months on the testicular tissue had been assessed by calorimetric measuring of oxidative biomarkers as malondialdehyde (MDA), reduced glutathione (GSH), superoxide dismutase (SOD) and nitric oxide (NO). The apoptotic effect was also determined by ELISA detection of B-cell lymphoma 2 (Bcl2), Bcl2 Associated X, Apoptosis Regulator (Bax), Bax/Bcl2 ratio, and caspase3 concentrations. The hormonal change of LH, FSH, and testosterone had been reported in serum as well as PCR quantification for the first time of both StAR and HSD17B3 gene expression that regulates the production of testosterone in rat testicular tissue.

Material

Animals

Thirty two male Wistar rats (250-350 g) were purchased from the animal breeding unit at the National Research Centre -Dokki- Giza – Egypt. Animals were housed in cages with water and food ad libitum, and the animal room temperature was kept at a constant temperature of 20 ± 1°C on a 12-hour light/12-hour dark cycle. Adequate measures were taken to minimize the pain or discomfort of the animals. Experimental protocol followed the Ethics and Animal Care Committee of the National Research Centre and following the recommendations of the National Institutes of Health Guide for Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978).

Drugs and reagents

Tramadol HCl was obtained from the Ministry of Justice - Egypt and boldenone undecylenate 5% oily solution (Equi-gan®; Lab Tornel, Co., Mexico). Other chemicals were of the highest commercial grade available.

ELISA kits

Rat B-cell CLL/lymphoma 2 (BCL2) ELISA kit (China-CUSABIO, Catalog number CSB-E08854r). Rat Apoptosis regulator BAX(BAX) ELISA kit (China- CUSABIO, Catalog number CSB-EL002573RA). Rat Caspase 3, Casp-3 ELISA Kit (China- CUSABIO, Catalog number CSB-E08857r). Rat luteinizing hormone (LH) Elisa kit (China-CUSABIO, Catalog number CSB-E12654r). Rat follicle-stimulating hormone, FSH ELISA Kit (China-CUSABIO, Catalog number CSB-E06869r). Rat Testosterone ELISA Kit (China-CUSABIO, Catalog number CSB-E05100r).

Experimental Protocol

Thirty two rats were randomly divided into four groups; Group 1: is kept as control negative, Group 2 injected tramadol HCl (20 mg/kg bwt.) daily intraperitoneally (i.p) (Hosseini-Sharifabad et al., 2016), Group 3 was injected boldenone undecylenate (5 mg/kg bwt) (i.m) per week (Bueno et al., 2017) and Group 4 was injected intraperitoneally a combination of tramadol HCl (20 mg/kg bwt.) and boldenone undecylenate (5 mg/kg bwt). Groups 2, 3, and 4 were treated for 2 months. 48 hours after the end of the experiment, blood samples were taken from the retroorbital plexus under a low dose of ketamine anesthesia for estimation of hormonal levels in serum (LH, FSH, and Testosterone) using ELISA kits and according to the manufacturer instruction. Animals were then sacrificed by cervical dislocation under anesthesia and both testes from all rats were extracted. One testis was kept in -80̊ C for colorimetric determination of malondialdehyde (MDA), reduced glutathione (GSH), superoxide dismutase (SOD), and nitric oxide (NO). Bcl2, Bax, and caspase-3 (Casp-3) were determined using the ELISA technique. StAR and HSD17B3 genes were quantified in tissue using real-time polymerase chain reaction (PCR). The other testis was kept in formalin 10% for histopathological and histochemical studies.

Preparation of tissue samples

One testis from each rat from all the groups were homogenized (MPW-120 homogenizer, Med instruments, Poland) in PBS to obtain 20% homogenate and kept overnight at –80°C. The homogenates were centrifuged for 5 minutes at 5000 x g using a cooling centrifuge (Sigma and laborzentrifugen, 2k15, Germany). The supernatant was taken immediately and used for oxidative stress biomarkers (MDA, GSH, SOD, and NO) using colorimetric kits according to the following methods (Ohkawa et al., 1979)(Ellman, 1959)(Nishikimi et al., 1972)(García-Robledo et al., 2014). Apoptotic markers Bcl2, Bax, and Caspase-3 (Casp-3) using specific ELISA kits according to manufacturer’s instructions. All results are calculated 1mg total protein

Detection of gene expression of StAR and HSD17B3 in testicular tissue by Quantitative real-time polymerase chain reaction (qRT-PCR):

Total RNA was isolated using Qiagen tissue extraction kit (Qiagen, USA) according to the instructions of the manufacturer. The total RNA was used for complementary DNA (cDNA) conversion using high-capacity cDNA reverse transcription kit (Fermentas, USA). Moloney murine leukemia virus (MMLV) reverse transcriptase was used for the synthesis of cDNA from RNA. Human Placental Ribonuclease Inhibitor (HPRI) was used for inhibition of RNase activity. Real-time qPCR amplification and analysis were performed using an Applied Biosystem with software version 3.1 (StepOne™, USA). The reaction contained SYBR Green Master Mix (Applied Biosystems), gene-specific primer pairs which were shown in table (1) and were designed with Gene Runner Software (Hasting Software, Inc., Hasting, NY) from RNA sequences from the gene bank. All the primer sets had a calculated annealing temperature of 60°. Amplification conditions were: 2 min at 50°, 10 min at 95°, and 40 cycles of denaturation for 15 s and annealing/extension at 60° for 10 min. The relative expression of the studied genes was calculated according to Applied Biosystem software using the comparative threshold cycle method. All values were normalized to the (BETA ACTIN) genes as an endogenous control (reference gene)

Table (1) Gene-specific primer pairs for StAR, 17β HSD and β actin

Primer sequence

StAR

Forward primer :5’- CGAAACCCTAGTCAGGCACA -3

Reverse primer:5’- - TGTCTCACTGTGGTCCAAGC -3

17 B HSD

Forward primer: 5-TTCTGCAAGGCTTTACCAGG-3

Reverse primer: 5-ACAAACTCATCGGCGGTCTT-3

βeta actin

Forward primer 5′-TGTTTGAGACCTTCAACACC-3′

Reverse primer 5′-CGCTCATTGCCGATAGTGAT-3′

Histological and histochemical samples

The other testis was removed and fixed in 10% neutral buffered formalin for 24 hrs, then dehydrated using series of ascending concentration of alcohol up to 100% alcohol, cleared in two changes of xylol and embedded in melted paraffin wax. Sections of 5µm thickness were cut using a rotatory microtome. For histological examination sections were stained by:

*Haematoxylin and Eosin (H&E) stain to assess the changes in the histological structure of the seminiferous tubules, degenerative and necrotic changes in the spermatogenic cells and interstitial cells of Leydig.

*PAS stain for histochemical assessment of polysaccharides and glycoproteins in the testes.

*Masson’s trichrome stain to assess the changes in the collagen fibers. Once staining, the sections were dehydrated with ethanol, cleared in xylene and mounted with “DPX”.(Bancroft & Gamble, 2019).

All parameters were assessed in 6 randomly selected non-overlapping fields per tissue section of each sample at a magnification of X400 using the image analyzer computer system (Leica Microsystems GmbH, Germany) operated by Leica Application software for tissue sections analysis. The optical density of both the positive PAS-stained material and collagen fibers were calculated.

STATISTICAL ANALYSIS

Data represented as mean ± SE. Statistical analysis was carried out by one-way analysis of variance (ANOVA) followed by Tukey-Kramer test for multiple comparisons.

Assessment of oxidative stress biomarkers

Animal groups injected intraperitoneally with tramadol 20mg/kg and boldenone 5mg/kg and their combination for 2 months showed a significant P<0.05 elevation in MDA and NO concentrations (MDA; 107.6±6.65, 105.68±7.74 and 142.12±9.67 nmol/mg protein) and (NO; 42.52±1.89, 42.7±4.63 and 69.6±0.47 nmol/mg protein) respectively when compared to control -ve group (MDA; 41.33±7.6 nmol/mg protein and NO; 15.66±1.34 nmol/mg protein). No significant difference occurred between groups injected with tramadol and boldenone. A noticeable significant increase P<0.05 was determined in group (4) injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg when compared with groups administered tramadol or boldenone alone.

Animal groups injected intraperitoneally with tramadol 20mg/kg and boldenone 5mg/kg and their combination for 2 months showed a significant P<0.05 decrease in GSH and SOD concentrations (GSH; 29.4±3.73, 30.04±2.26 and 19.62±2.15 Mmol/mg protein) and (SOD; 21.84±2.05, 22.92±2.11 and 16.76±2.5 U/mg protein) respectively, when compared to control -ve group (GSH; 58.4±0.57 nmol/mg protein and SOD; 43.97±5.57 nmol/mg protein). No significant difference occurred between groups injected with tramadol and boldenone. A noticeable significant decrease P<0.05 was determined in group (4) injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg when compared with groups administered tramadol or boldenone alone. Results are represented in table (2).

Table (2) Effect of IP injection of tramadol and IM injection of boldenone alone and in combination on oxidative stress biomarkers in testicular tissue

Groups	MDA nmol/mg protein	GSH Mmol/mg protein	SOD U/mg protein	NO nmol/mg protein
Control -ve	41.33±7.6	±58.400.57	43.97±5.57	15.66±1.34
Tram. 20mg/kg	107.6±6.65^a	±29.43.73^a	21.84±2.05^a	42.52±1.89^a
Bol. 5mg/kg	105.68±7.74^a	±30.042.26^a	22.92±2.11^a	42.7±4.63^a
Tram.20mg/kg+Bol. 5mg/kg	142.12±9.67^abc	±19.622.15^abc	14.28±2.5^abc	69.6±5.47^abc
Data are expressed as (mean ± SE). Statistics were done by One-way ANOVA and confirmed by Tukey’s test. Tram.; Tramadol, Bol.; Boldenone, MDA; Malondialdehyde, GSH; Reduced glutathione, SOD; Superoxide dismutase, NO; Nitric oxide, IP; Intraperitoneal.
^a P<0.05: Statistically significant from control -ve group
^b P<0.05: Statistically significant from Tramadol
^c P<0.05: Statistically significant from Boldenone

Assessment of apoptotic biomarkers

Bax is an apoptotic protein while Bcl-2 is an anti-apoptotic protein, and the ratio of those proteins determines the occurrence of cell apoptosis. Caspase-3 is also one of the major effectors of apoptosis, and its activation of caspase-3 indicates irreversible cell apoptosis. Animal groups injected intraperitoneally with tramadol 20mg/kg and boldenone 5mg/kg and their combination for 2 months showed a significant P<0.05 increase in Bax concentrations (258.88±13.88, 256.44±14.41 and 293.62±10.33 pg/mg protein) respectively when compared to control -ve group (115.62±1.85 pg/mg protein). No significant difference occurred between groups injected with tramadol and boldenone. A noticeable significant increase P<0.05 was determined in group (4) injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg when compared with groups administered tramadol or boldenone alone. On the other hand, animal groups injected intraperitoneally with tramadol 20mg/kg and boldenone 5mg/kg and their combination for 2 months showed a significant P<0.05 decrease in Bcl2 concentrations (62.98±7.71, 67.5±1.1 and 47.46±2.15 pg/mg protein) respectively when compared to control -ve group (140.46±6.28 pg/mg protein). No significant difference occurred between groups injected with tramadol and boldenone. A noticeable significant decrease P<0.05 was determined in group (4) injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg when compared with groups administered tramadol or boldenone alone. Bax/Bcl2 ratio act as a marker for the determination of cell susceptibility to apoptosis. Groups injected with tramadol, boldenone, and their combination showed a remarkable increase in Bax/Bcl2 ratio (4.11, 3.9, and 6.19) we can notice that Bax/Bcl2 ratio for groups given tramadol and boldenone showed nearly the same ratio while the group 4 injected with the combination showed significant higher ratio than both group 2 and 3. Caspase-3 is another apoptotic biomarker that showed the same results as those of Bax where we found that the groups injected intraperitoneally with tramadol 20mg/kg and boldenone 5mg/kg and their combination for 2 months showed a significant P<0.05 increase in caspase-3 concentrations (4.9±0.61, 5.12±0.42 and 6.76±0.26 ng/mg protein) respectively when compared to control -ve group (1.68±0.2 pg/mg protein). No significant difference occurred between groups injected with tramadol and boldenone. A noticeable significant increase P<0.05 was determined in group (4) injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg when compared with groups administered tramadol or boldenone alone. Results are represented in table (3).

Table (3) Effect of IP injection of tramadol and IM injection of boldenone alone and in combination on apoptotic biomarkers in testicular tissue

Groups	Bax pg/mg protein	Bcl2 pg/mg protein	Bax/Bcl2 ratio	Caspase-3 ng/mg protein
Control -ve	115.62±1.85	±140.466.28	0.82	1.68±0.2
Tram. 20mg/kg	258.88±13.88^a	±62.987.71^a	4.11(501.2%)	4.9±0.61^a
Bol. 5mg/kg	256.44±14.41^a	±67.51.1^a	3.9(475.6%)	5.12±0.42^a
Tram.20mg/kg+Bol.5mg/kg	293.62±10.33^abc	±47.462.15^abc	6.19(754.8%)	6.76±0.26^abc
Data are expressed as (mean ± SE). Statistics were done by One-way ANOVA and confirmed by Tukey’s test. Tram.; Tramadol, Bol.; Boldenone, Bax; Bcl2 Associated X, Apoptosis Regulator, Bcl2; B-cell lymphoma 2, IP; Intraperitoneal.
^a P<0.05: Statistically significant from control -ve group
^b P<0.05: Statistically significant from Tramadol
^c P<0.05: Statistically significant from Boldenone

Determination of hormonal changes in serum

Animal groups injected intraperitoneally with tramadol 20mg/kg for 2 months showed a significant P<0.05 decrease in LH, FSH, and testosterone (3.62±0.09, 5.26±0.2 mIU/ml and 69.5±0.79 pg/ml) respectively, as compared to the control-ve group (5.48±0.4, 3.22±0.11 mIU/ml and 31.2±0.2 pg/ml) respectively. Intraperitoneal injection of boldenone 5mg/kg for 2 months showed a significant P<0.05 decrease in concentrations of LH, FSH, and testosterone in serum (2.29±0.05, 2.56±0.09 mIU/ml, and 22.9±0.36 pg/ml) respectively, as compared to control-ve and to the group injected with tramadol alone. The group injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg showed a significant P<0.05 decrease in LH and FSH in serum (1.8±0.06 and 1.94±0.03 mIU/ml) respectively, as compared to control-ve and to the group injected with tramadol alone. It was also shown that injection with combination does not show a significant P<0.05 difference in testosterone concentration in serum (17.5±0.14 pg/ml) when compared with the group injected with boldenone only. Results are presented in table (4).

Table (4) Effect of IP injection of tramadol and IM injection of boldenone alone and in combination on hormonal changes in serum

Groups	LH mIU/ml	FSH mIU/ml	Free Testosterone pg/ml
Control -ve	5.48±0.4	±5.260.2	69.5±0.79
Tram. 20mg/kg	3.62±0.09^ac	±3.220.11^ac	31.2±0.2^ac
Bol. 5mg/kg	2.29±0.05^ab	±2.560.09^ab	22.9±0.36^ab
Tram.20mg/kg+Bol.5mg/kg	1.8±0.06^abc	±1.940.03^abc	17.5±0.14^ab
Data are expressed as (mean ± SE). Statistics were done by One-way ANOVA and confirmed by Tukey’s test. Tram.; Tramadol, Bol.; Boldenone, LH; Luteinizing hormone, FSH; Follicle-stimulating hormone, IP; Intraperitoneal.
^a P<0.05: Statistically significant from control -ve group
^b P<0.05: Statistically significant from Tramadol
^c P<0.05: Statistically significant from Boldenone

Assessment of gene expression of StAR and HSD17B3 in testicular tissue by Quantitative real-time polymerase chain reaction (qRT-PCR):

Animal groups injected intraperitoneally with tramadol 20mg/kg and boldenone 5mg/kg and their combination for 2 months showed a significant P<0.05 decrease in StAR and 17β HSD genes expression (StAR; 0.474±0.04, 0.482±0.07 and 0.314±0.02 Copiesx10^4 /mg protein) and (17β HSD; 0.382±0.08, 0.392±0.07 and 0.22±0.02 Copiesx10^4 /mg protein) respectively, when compared to control -ve group (StAR; 1.014±0.009 Copiesx10^4 /mg protein and 17β HSD; 1.01±0.006 Copiesx10^4 /mg protein). No significant difference occurred between groups injected with tramadol and boldenone. A noticeable significant increase P<0.05 was detected in group (4) injected with a combination of tramadol 20mg/kg + boldenone 5mg/kg when compared with groups administered tramadol or boldenone alone. Results are represented in figure (1a,1b).

Histological and Histochemical Results:

H&E-stained sections of the testes in control group showed, numerous seminiferous tubules that were surrounded by a basement membrane. Each tubule was lined by spermatogenic cells and Sertoli cells. Spermatogenic cells were arranged in many layers started by spermatogonia next to the basement membrane, followed by primary spermatocytes with their large, rounded nuclei, and condensed chromosomes. Secondary spermatocytes were seen in the sections. Spermatids were noticed as round cells having deeply stained nuclei near the lumen. Meanwhile, the mature sperms were seen in the centre of the lumen of the seminiferous tubules. Sertoli cells were seen resting on the basement membrane between the spermatogenic cells with its pyramidal shape and large oval basal nuclei. The tubules separated from each other by loose interstitial connective tissue containing the Leydig cells with vesicular nuclei [Figure 2(a)]

Examination of H&E-stained sections of the testes in tramadol-treated group showed deformed seminiferous tubules with missing their normal histological architecture. Many tubules showed degenerative changes in the form of nuclear pyknosis, cytoplasmic vacuoles and detached spermatogenic cells. Multinucleated giant cells were also seen in the lumen of the seminiferous tubules with absence of sperms. Hyalinosed homogenous material and congested blood vessels were also seen in the interstitium [Figure 3 (a)]. Examination of H&E-stained sections of the testes in boldenone-treated group showed nearly the same histological picture with no detectable variation in comparison with tramadol-treated group [Figure 4 (a)]. Examination of H&E-stained sections of the testes in tramadol/boldenone-treated group showed no detectable changes in the histological picture in comparison with tramadol-treated group [Figure 5(a)].

PAS-stained sections of testes in control group, showed PAS positive reaction in the testicular capsule, basement membrane of the seminiferous tubules and in the interstitial tissue in between the tubules [Figure 2(b)]. In both tramadol-treated group, boldenone-treated group and tramadol/boldenone-treated group, mild positive PAS reaction was showed in the interstitial tissue between the tubules and in the testicular capsule. Statistically, tramadol-treated group, boldenone-treated group and tramadol/boldenone-treated group showed a significant P<0.05 decrease in PAS positive material mean optical density (0.1316±0.201, 0.1233±0.193 and 0.1233± 0.193) as compared to the control group (0.2405±0.403). In the meantime, there was no statistically significant difference between the last three groups [Figure 3 (b), 4 (b) and 5 (b)]

Masson’s trichrome-stained sections of testes in control group, showed collagen fiber deposition in tunica albuginea [Figure 2 (c)]. In both tramadol-treated group, boldenone-treated group and tramadol/boldenone-treated group, abundant collagen fibers deposits in tunica albuginea and minimal amount of collagen fibers in the interstitial tissue were found.

Statistically, tramadol-treated group, boldenone-treated group and tramadol/boldenone-treated group showed a significant P<0.05 increase in collagen fiber optical density (0.5123± 0.184, 0.4963± 0.172and 0.4882± 0.187) as compared to the control group (0.3071± 0.260). In the meantime, there was no statistically significant difference between the last three groups [Figure 3 (c), 4 (c) and 5 (c)].

About 50% of the infertility conditions are attributed to male factors (Wu et al., 2020). The main cause of male infertility is still unknown but about 30-80% of the cases were attributed to the release of a high amount of reactive oxygen species (ROS) (Tremellen, 2008). Many drugs are implicated in infertility disorders due to the induction of oxidative stress (Smith et al., 2006). The testis is considered a susceptible organ to lipid peroxidation due to its high lipid content and high O2 consumption (Ilbey et al., 2009)(Hassan et al., 2019). This oxidative stress occurs due to an imbalance between ROS and the endogenous antioxidant defense system. Excessive ROS levels lead to detrimental deviations, that can abolish lipids, proteins, nucleic acids, and other cellular compounds, followed by cellular death (Konuk et al., 2012). Consequently, elevated ROS levels in testicular tissue might cause infertility (Ebokaiwe et al., 2015).

In the current study, our findings revealed that intraperitoneal injection of tramadol (20 mg/kg) to male rats for 2 months increased the level of oxidative stress evidenced by elevated MDA and NO and on the other hand a significant decrease in GSH and SOD levels in testicular tissue. Accordingly, we concluded that oxidative stress is well-thought to be a principal factor in the induction and progression of tramadol-induced reproductive toxicity (Ahmed & Kurkar, 2014). Our findings were in agreement with the prior studies reported by Abdel-Latif Ibrahim et al (M. A. L. Ibrahim & Salah-Eldin, 2019), and Ghoneim et al (Ghoneim et al., 2014), Who reported that MDA levels were significantly elevated after tramadol exposure in some tissues. In the current research, intraperitoneal injection of tramadol (20 mg/kg) significantly decreased the intracellular GSH content in testicular tissue, compared to the control group. Same findings recorded by, Ghoneim et al (Ghoneim et al., 2014) and Sheweita et al (Sheweita et al., 2018). Deficiency of the antioxidant system was evidenced by depletion of GSH levels in testicular tissue which in turn leads to a further increase in MDA levels. This condition can be followed by necrosis and apoptosis due to oxidation of the thiol group in the proteins of the mitochondrial membrane (Kandemir et al., 2017). Our results also revealed a significant decrease in SOD activity, which agreed with some previous studies (Ahmed & Kurkar, 2014) (M. A. L. Ibrahim & Salah-Eldin, 2019). The depletion of GSH and SOD indicates suppression of ROS scavenging capability. Our findings also showed NO levels in testicular tissue were increased, when compared to the control group. In parallel with our results, previous findings suggested that tramadol might induce testicular dysfunction due to the augmented production of NO and oxidative stress (Bodera et al., 2013). Our results also revealed that intraperitoneal injection of boldenone (5 mg/kg) induced oxidative stress in testicular tissue which was indicated by significant increase in MDA and NO and on the other hand a significant lowering of GSH and SOD in testiculat tissue. In a previous study (Behairy et al., 2020), authors verified an elevation of MDA and No as well as a decreament of SOD and GSH in rabbits due to injection with boldenone. Furthermore, a significant induction of lipid peroxidation, as well as complete inhibition of antioxidant capacity in testicular tissues in rats (S. S. Ibrahim & Said, 2019).

Physiologically, testis undergoes programmed cell death (apoptosis) to get rid of damaged cells (Turner & Lysiak, 2008). On the other hand, it was reported that there is a significant relationship between apoptosis and male infertility (Chen et al., 2006). Two important molecules are implicated in cell death; Bax (proapoptotic) and Bcl2 (antiapoptotic) and their ratio decides if the cell will experience apoptosis and in addition, caspase3 represents the intrinsic pathway of apoptosis (Arisha et al., 2019). Bcl2 can as well regulate the activity of caspase indirectly through heterodimerization of Bcl2 with Bax to prevent apoptosis (M. A. L. Ibrahim & Salah-Eldin, 2019), so cellular apoptosis is attributed to dysregulation of Bcl2 or Bax (Atici et al., 2004). In the current study, our findings reported that injection of tramadol for 2 months resulted in a significant increase in Bax and a significant decrease in Bcl2 leading to an increase in Bax/Bcl2 ratio. Additionally, tramadol induced caspase3 activity. All these findings indicate the presence of cellular apoptosis in testicular cells. Our results were in agreement with (Koohsari et al., 2020) who recorded an upregulation of Bax and caspase3 and a downregulation of Bcl2. Similar findings were recorded in rat cerebral cortex and lung tissues (Awadalla & Salah-Eldin, 2016). Similarly, the injection of boldenone for 2 months showed a significant dysregulation of apoptotic biomarkers; Bax, Bcl2 and caspase3 as recorded in tramadol injection, indicating the existence of apoptosis. Previous study conducted on rabbits, results revealed that boldenone leads to activation of apoptosis in liver parenchyma and upregulation of caspases activity (Mayada et al., 2015).

The reproductive efficiency of male and female is attributed maily to hypothalamic-pituitary-gonadal axis so any interference in this axis might lead to reduced or complete infertility (Faccio et al., 2013). Exposure of testes to heavy metals or any toxicants can cause damage of the mitochondria and downregulate expression of steroidogenic acute regulatory protein (StAR) and then inhibiting secretion of steroids. In the current study, injection of tramadol for 2 months had significantly reduced the serum levels of FSH, LH and testosterone. Previous study conducted on tramadol showed similar results (Abdellatief et al., 2015). These findings may be due the interference of opioids with the normal release of GnRH at the level of the hypothalamusleading to the decrease of FSH, LH and testerone (Aloisi et al., 2009). Injection of boldenone also for 2 months revealed similar results as those obtaine in groups injected with tramadol showing a significant reduction in FSH, LH and testosterone levels in serum. These results are in agreement with those of Behairy et al (2020) (Behairy et al., 2020). We also reported a significant downregulation of StaR and HSD17B3 expression after injection of both tramadol and boldenone. Reduction of steroid levels as well as downregulation of StaR and HSD17B3 may be attributed to elevated levels of ROS and reduction of antioxidant capacity as SOD, glutathione peroxidase (Yan et al., 2019) and finally leading to down regulation of StaR and HSD17B3 (Arisha et al., 2019). Mixture of tramadol and boldenone had been injected in rats for the first time to scout their additive effect because nowadays both drugs are being concurrently abused specially between youth. We found that the mixture showed significant detrimental effect in most of the parameters as compared to the grous administered the drugs alone.

In summary, we have illuminated the possible underlying mechanisms beyond tramadol and boldenone testicular dysfunction when used for 2 months. The testicular tissue toxicity has been attributed to elevation of ROS and reduction of antioxidant capacity as well as interference with release of steroids in normal levels. We also concluded the implication of these drugs alone or in combination in inducing apoptosis in testicular tissue. Unfavorable histological injury on the testicular tissue has been also verified. Finally, we concluded that the use of these drugs in combination has the worst effect.

ACKNOWLEDGMENT

Authors would like to thank the National Research Centre and Faculty of Medicine, Suez Canal University to give us opportunity to use the laboratories for conducting our research work.

Ethical approval : Experimental protocol followed the Ethics and Animal Care Committee of the National Research Centre and following the recommendations of the National Institutes of Health Guide for Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978).

Consent to participate: not applicable

Consent to publish : not applicable

Author contribution:

Gihan F.Asaad , Marwa E.A. El-Shamarka and Noha A.Mowaad performed the experiments, analyzed the data, prepared figures and tables, and authored and wrote the manuscript. Noha A.Mowaad and Marwa E.A. El-Shamarka conceived and designed the experiments. Noha A.Mowaad ,Sahar Khali and Marwa E.A. El-Shamarka analyzed the data and reviewed drafts of the manuscript. Gihan F.Asaad, Sahar Khalil and Noha A.Mowaad performed the docking molecular study and reviewed the paper. Noha A.Mowaad, Sahar Khalil ,Gihan F.Asaad and Marwa E.A. El-Shamarka contributed reagents/ materials/analysis tools, supervised the research, and reviewed the manuscript. All authors read and approved the fnal version of the manuscript. The authors declare that all data were generated in-house and that no paper mill was used.

The authors declare that all the data were generated in-house and no paper mill was used

Funding sources: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sec

Conflicts of interest: The authors declare no conflict of interest

Data availability as supplementary materials and upon request

Code availability: not applicable

Abdellatief RB, Elgamal DA, Mohamed EEM (2015) Effects of chronic tramadol administration on testicular tissue in rats: An experimental study. Andrologia 47(6):674–679. https://doi.org/10.1111/and.12316
Ahmed MA, Kurkar A (2014) Effects of opioid (tramadol) treatment on testicular functions in adult male rats: The role of nitric oxide and oxidative stress. Clin Exp Pharmacol Physiol 41(4):317–323. https://doi.org/10.1111/1440-1681.12213
Aloisi AM, Aurilio C, Bachiocco V, Biasi G, Fiorenzani P, Pace MC, Paci V, Pari G, Passavanti G, Ravaioli L, Sindaco G, Vellucci R, Ceccarelli I (2009) Endocrine consequences of opioid therapy. Psychoneuroendocrinology, 34(SUPPL. 1). https://doi.org/10.1016/j.psyneuen.2009.05.013
Aminiahidashti H, Shafiee S, Mousavi SJ, Hajiaghaei G (2016) Tramadol pill alone may cause serotonin syndrome. Chinese Medical Journal (Vol 129:877–878. https://doi.org/10.4103/0366-6999.178957
Arisha AH, Ahmed MM, Kamel MA, Attia YA, Hussein MMA (2019) Morin ameliorates the testicular apoptosis, oxidative stress, and impact on blood–testis barrier induced by photo-extracellularly synthesized silver nanoparticles. Environ Sci Pollut Res 26(28):28749–28762. https://doi.org/10.1007/s11356-019-06066-1
Atici S, Cinel L, Cinel I, Doruk N, Aktekin M, Akca A, Camdeviren H, Oral U (2004) Opioid neurotoxicity: Comparison of morphine and tramadol in an experimental model. Int J Neurosci 114(8):1001–1011. https://doi.org/10.1080/00207450490461314
Awadalla EA, Salah-Eldin AE (2016) Molecular and histological changes in cerebral cortex and lung tissues under the effect of tramadol treatment. Biomedicine and Pharmacotherapy 82:269–280. https://doi.org/10.1016/j.biopha.2016.04.024
Bancroft Jd, Gamble M (2019) Bancroft’s Theory and Practice of Histological Techniques. Bancroft’s Theory and Practice of Histological Techniques. Elsevier. https://doi.org/10.1016/c2015-0-00143-5
Bar-Or D, Salottolo KM, Orlando A, Winkler JV (2012) A randomized double-blind, placebo-controlled multicenter study to evaluate the efficacy and safety of two doses of the tramadol orally disintegrating tablet for the treatment of premature ejaculation within less than 2 minutes. Eur Urol 61(4):736–743. https://doi.org/10.1016/j.eururo.2011.08.039
Behairy A, El-Sharkawy NI, Saber TM, Soliman MM, Metwally MMM, El-Rahman A, Abd-Elhakim GI, Deib E, M. M (2020) The modulatory role of vitamin C in boldenone undecylenate induced testicular oxidative damage and androgen receptor dysregulation in adult male rats. Antioxidants 9(11):1–16. https://doi.org/10.3390/antiox9111053
Bodera P, Stankiewicz W, Zawada K, Antkowiak B, Paluch M, Kieliszek J, Kalicki B, Bartosinski A, Wawer I (2013) Changes in antioxidant capacity of blood due to mutual action of electromagnetic field (1800MHz) and opioid drug (tramadol) in animal model of persistent inflammatory state. Pharmacological Reports 65(2):421–428. https://doi.org/10.1016/S1734-1140(13)71017-X
Bueno A, Carvalho FB, Gutierres JM, Lhamas C, Andrade CM (2017) A comparative study of the effect of the dose and exposure duration of anabolic androgenic steroids on behavior, cholinergic regulation, and oxidative stress in rats. PLoS ONE 12(6). https://doi.org/10.1371/journal.pone.0177623
Chen Z, Hauser R, Trbovich AM, Shifren JL, Dorer DJ, Godfrey-Bailey L, Singh NP (2006) The relationship between human semen characteristics and sperm apoptosis: A pilot study. J Androl 27(1):112–120. https://doi.org/10.2164/jandrol.05073
Coward RM, Rajanahally S, Kovac JR, Smith RP, Pastuszak AW, Lipshultz LI (2013) Anabolic steroid induced hypogonadism in young men. J Urol 190(6):2200–2205. https://doi.org/10.1016/j.juro.2013.06.010
Dohle GR, Smit M, Weber RFA (2003) Androgens and male fertility. World J Urol 21(5):341–345. https://doi.org/10.1007/s00345-003-0365-9
Ebokaiwe AP, D’Cruz CS, Jubendradass R, Amala Rani JS, Mathur PP, Farombi EO (2015) Nigerian bonny-light crude oil induces alteration in testicular stress response proteins and caspase-3 dependent apoptosis in albino wistar rats. Environ Toxicol 30(2):242–252. https://doi.org/10.1002/tox.21902
El Sawy MM, Malak HWA (2015) Effect of tramadol abuse on testicular tissue of adult albino rats: A light and electron microscopic study. Egyptian Journal of Histology 38(2):356–366. https://doi.org/10.1097/01.EHX.0000464775.44998.4a
Ellman GL (1959) Tissue sulfhydryl groups. Arch Biochem Biophys 82(1):70–77. https://doi.org/10.1016/0003-9861(59)90090-6
Faccio L, Da Silva AS, Tonin AA, França RT, Gressler LT, Copetti MM, Oliveira CB, Sangoi MB, Moresco RN, Bottari NB, Duarte M, M. M. F., Monteiro SG (2013) Serum levels of LH, FSH, estradiol and progesterone in female rats experimentally infected by Trypanosoma evansi. Exp Parasitol 135(1):110–115. https://doi.org/10.1016/j.exppara.2013.06.008
Fawzi MM (2011) Medicolegal Aspects Concerning Tramadol Abuse. The New Middle East Youth Plague: An Egyptian Overview 2010. Journal of Forensic Research 02(04). https://doi.org/10.4172/2157-7145.1000130
García-Robledo E, Corzo A, Papaspyrou S (2014) A fast and direct spectrophotometric method for the sequential determination of nitrate and nitrite at low concentrations in small volumes. Mar Chem 162:30–36. https://doi.org/10.1016/j.marchem.2014.03.002
Ge R, Hardy MP (2007) Regulation of Leydig Cells During Pubertal Development. In The Leydig Cell in Health and Disease (pp. 55–70). https://doi.org/10.1007/978-1-59745-453-7_4
Ghoneim FM, Khalaf HA, Elsamanoudy AZ, Helaly AN (2014) Effect of chronic usage of tramadol on motor cerebral cortex and testicular tissues of adult male albino rats and the effect of its withdrawal: Histological, immunohistochemical and biochemical study. Int J Clin Exp Pathol 7(11):7323–7341
Hassan E, Kahilo K, Kamal T, El-Neweshy M, Hassan M (2019) Protective effect of diallyl sulfide against lead-mediated oxidative damage, apoptosis and down-regulation of CYP19 gene expression in rat testes. Life Sci 226:193–201. https://doi.org/10.1016/j.lfs.2019.04.020
Hosseini-Sharifabad A, Rabbani M, Sharifzadeh M, Bagheri N (2016) Acute and chronic tramadol administration impair spatial memory in rat. Research in Pharmaceutical Sciences 11(1):49–57
Ibrahim MAL, Salah-Eldin AE (2019) Chronic addiction to tramadol and withdrawal effect on the spermatogenesis and testicular tissues in adult male albino rats. Pharmacology 103(3–4):202–211. https://doi.org/10.1159/000496424
Ibrahim SS, Said AM (2019) Effect of Lycopene in Amelioration of Testicular and Renal Toxicity Induced By Boldenone Undecylenate in Male Albino Rats. International Journal of Medical and Biomedical Studies 3(3). https://doi.org/10.32553/ijmbs.v3i3.124
Ilbey YO, Ozbek E, Cekmen M, Simsek A, Otunctemur A, Somay A (2009) Protective effect of curcumin in cisplatin-induced oxidative injury in rat testis: Mitogen-activated protein kinase and nuclear factor-kappa B signaling pathways. Hum Reprod 24(7):1717–1725. https://doi.org/10.1093/humrep/dep058
Kandemir FM, Kucukler S, Eldutar E, Caglayan C, Gülçin İ (2017) Chrysin protects rat kidney from paracetamol-induced oxidative stress, inflammation, apoptosis, and autophagy: Amulti-biomarker approach. Sci Pharm 85(1). https://doi.org/10.3390/scipharm85010004
Konuk M, Şahin T, Ciǧerci IH, Fidan AF, Korcan SE (2012) Effects of α-lipoic acid on DNA damage, protein oxidation, lipid peroxidation, and some biochemical parameters in sub-chronic thinner-addicted rats. Turkish Journal of Biology 36(6):702–710. https://doi.org/10.3906/biy-1204-56
Koohsari M, Ahangar N, Mohammadi E, Talebpour Amiri F, Shaki F (2020) Effects of tramadol administration on male reproductive toxicity in Wistar rats: The role of oxidative stress, mitochondrial dysfunction, apoptosis-related gene expression, and nuclear factor kappa B signalling. Bratislava Medical Journal 121(6):400–410. https://doi.org/10.4149/BLL_2020_065
Mayada RF, Taghred MS, Haytham AA (2015) Boldenone-induced apoptotic, structural, and functional alterations in the liver of rabbits. World Rabbit Science 23(1):39–46. https://doi.org/10.4995/wrs.2015.2261
Nishikimi M, Appaji Rao N, Yagi K (1972) The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem Biophys Res Commun 46(2):849–854. https://doi.org/10.1016/S0006-291X(72)80218-3
Oda SS, El-Ashmawy IM (2012) Adverse effects of the anabolic steroid, boldenone undecylenate, on reproductive functions of male rabbits. Int J Exp Pathol 93(3):172–178. https://doi.org/10.1111/j.1365-2613.2012.00814.x
Oduwole OO, Peltoketo H, Huhtaniemi IT (2018) Role of follicle-stimulating hormone in spermatogenesis. In Frontiers in Endocrinology (Vol. 9). https://doi.org/10.3389/fendo.2018.00763
Ohkawa H, Ohishi N, Yagi K (1979) Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 95(2):351–358. https://doi.org/10.1016/0003-2697(79)90738-3
Sharma R, Biedenharn KR, Fedor JM, Agarwal A (2013) Lifestyle factors and reproductive health: Taking control of your fertility. In Reproductive Biology and Endocrinology (Vol. 11, Issue 1). https://doi.org/10.1186/1477-7827-11-66
Sheweita SA, Almasmari AA, El-Banna SG (2018) Tramadol-induced hepato- and nephrotoxicity in rats: Role of Curcumin and Gallic acid as antioxidants. PLoS ONE 13(8). https://doi.org/10.1371/journal.pone.0202110
Smith R, Kaune H, Parodi D, Madariaga M, Rios R, Morales I, Castro A (2006) Increased sperm DNA damage in patients with varicocele: Relationship with seminal oxidative stress. Hum Reprod 21(4):986–993. https://doi.org/10.1093/humrep/dei429
Stocco DM (2001) Tracking the role of a StAR in the sky of the new millennium. In Molecular Endocrinology (Vol. 15, Issue 8, pp. 1245–1254). https://doi.org/10.1210/mend.15.8.0697
Tremellen K (2008) Oxidative stress and male infertility - A clinical perspective. In Human Reproduction Update (Vol. 14, Issue 3, pp. 243–258). https://doi.org/10.1093/humupd/dmn004
Turner TT, Lysiak JJ (2008) Oxidative stress: A common factor in testicular dysfunction. Journal of Andrology (Vol 29:488–498. https://doi.org/10.2164/jandrol.108.005132
Wu PY, Scarlata E, O’flaherty C (2020) Long-term adverse effects of oxidative stress on rat epididymis and spermatozoa. Antioxidants 9(2). https://doi.org/10.3390/antiox9020170
Yan M, Li L, Mao B, Li H, Li SYT, Mruk D, Silvestrini B, Lian Q, Ge R, Cheng XCY (2019) mTORC1/rpS6 signaling complex modifies BTB transport function: An in vivo study using the adjudin model. American Journal of Physiology - Endocrinology and Metabolism 317(1):E121–E138. https://doi.org/10.1152/ajpendo.00553.2018

Cross Talk Between Down Regulation of Steroidogenic Genes Expression, Oxidative and Apoptotic Biomarkers in Testes Induced by Administration of Tramadol and Boldenone and Their Combination in Male Albino Rats

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods