1.1 Ethics Statement
This study protocol was approved by the Institutional Review Committee on Human Research of the First People's Hospital of Chenzhou, Hunan Province, China (reference number 2018-012). Informed consent was obtained from all individual participants included in the study, including all patients and the healthy controls. The study was registered with the US National Institutes of Health Clinical Trials Register (NCT: 04079777) and was performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.
1.2 Study Population
From July 1, 2018 to January 31, 2020, a total of 26 consecutive patients with SAP were recruited for the prospective study after they were admitted to the general intensive care unit (ICU) of the First People's Hospital of Chenzhou. Ten healthy adult volunteers who received physical examination were recruited as the control group.
1.3 Diagnosis and Definition of Severity
The diagnosis of acute pancreatitis requires two of the following three features: (1) Abdominal pain consistent with acute pancreatitis (acute onset of a persistent, severe, epigastric pain often radiating to the back); (2) serum lipase activity (or amylase activity) at least three times higher than the upper limit of normal; and (3) characteristic findings of acute pancreatitis on computed tomography (CT) and less commonly, magnetic resonance imaging (MRI) or transabdominal ultrasonography. Severe acute pancreatitis is characterized by persistent organ failure, which is defined as organ failure that persists for > 48 h[15].
1.4 Inclusion Criteria and Exclusion Criteria
Consecutive adult (at least 18 years old) patients with SAP admitted to the ICU were assessed for inclusion. The following patients were excluded: (1) Those who suffered SAP for more than 48 h before admission; (2) those who did not give their consent; (3) those with cancer; (4) pregnant patients; (5) those with hepatosis, defined as a Child Pugh C score of more than grade II; (6) those who had received or were receiving high-dose steroid treatment; (7) those who required renal replacement therapy (RRT); (8) those who had contracted AIDS; (9) those who had participated in other studies; and (10) those with a history of renal transplant. The following patients withdrew from the study during the period of observation: (1) Those who declined treatment or who died; (2) those who received blood transfusion of more than 1000 ml; (3) The patient's clinical experimental data were incomplete; or (4) The patients or their family members requested to withdraw.
1.5 Clinical Data Collection and Treatment
Upon admission to the general ICU, data on the patients’ baseline characteristics were collected, including age, sex, etiological factors, and underlying diseases. Clinical biomarkers of SAP were also collected, such as the WBC count, and C-reactive protein (CRP), procalcitonin (PCT), and Ca2+ levels. In addition, other physiological and clinical information was collected and the condition of the disease was assessed using the APACHE II, SOFA, and Ranson scores. The clinical treatment of patients with SAP included in the study were based on the clinical guidelines for acute pancreatitis[16].
1.6 Blood Sample Collection
After admission, samples were taken at four time points: At admission, and on days 3, 5, and 7 after admission. Blood samples were collected into Ethylene Diamine Tetra-acetic Acid (EDTA)-containing tubes and processed within 1 h{#1}. The samples were centrifuged at 1000 × g for 10 min. The freshly isolated plasma was transferred into a clear polypropylene tube and then centrifuged at 12,000 × g for another 10 min to prepare the cell free plasma. The plasma was stored at -80 °C until further mtDNA extraction and detection.
1.7 Extraction and Detection of mtDNA
The mtDNA was extracted using a mtDNA isolation kit following the manufacturer’s standard protocol[17]. Detection of plasma mtDNA was performed as reported previously[18]. Briefly, 200 μl cell-free plasma per patient was used for DNA isolation using an animal mtDNA column extraction kit (Sequencing Grade) (LMAI Bio - 120501) according to manufacturer’s instructions. The extracted DNA was eluted using 200-μl gallium (GA) buffer and detected for nucleic purity using SMA4000 spectrophotometer (Merinton, Ann Arbor, MI, USA). The plasma mtDNA concentration was measured by determining the level of the human mitochondrial cytochrome B (h-mt-cytB) genes (ID: NC_012920.1) using a real-time quantitative PCR assay performed on a 7500 real-time PCR system (ABI-7500, Applied Biosystems, Foster City, CA, USA). Two microliters (2.0 μg) of plasma DNA solution was added into a reaction solution containing 2.0 μl of PCR forward primer (2 μM), 2.0 μl of PCR reverse primer (2 μM), 0.4 μl of 50 × Rox Reference Dye and 3.6 μl of ddH2O to a final volume of 10 μl. Primers for the h‑-mt-cytB genes were: Forward: 5′ - CTAGGCGACCCAGACAATTATAC- 3′ and reverse: 5′ - TTAGGGACGGATCGGAGAAT - 3′. The thermal profile was set up as follows: An initial denaturation step at 95 °C for 10 min, followed by 40 cycles of a denaturation step at 55 °C for 20 s and an annealing step at 95 °C for 10 s. The melting curve was obtained when the temperature was raised from 55 °C to 95 °C. The purity and quantity of the mtDNA amplicons were assessed using the absorbance at 260/280 nm and 260 nm, separately. This pure mtDNA was used for standard curve establishment. The absolute mtDNA concentration was calculated according to the standard curve. Each sample was run in triplicate, and the mean value was used for further analysis.
1.8 Statistical Analysis
The data were processed using Statistical Product and Service Solutions (SPSS) 19.0 (IBM Corp., Armonk, NY, USA) software. The measured data that followed a normal distribution in this analysis were expressed as the mean ± the standard deviation, such as age, body mass index (BMI), APACHE II score, SOFA score, and the concentration of mtDNA, Ca2+. Other measured data, such the time of symptom onset, and the levels of CRP and PCT, were expressed as median values (25th and 75th percentiles). The changes in plasma mtDNA levels over time and the plasma mtDNA concentration of patients with SAP with different etiologies or BMI were compared using an analysis of variance (ANOVA). Two-way ANOVA analysis was used to assess whether the trend of clinical data, score systems, and mtDNA levels remained statistically consistent. For correlation analysis among mtDNA, clinical data, and score systems, Pearson correlation coefficient analysis was used. To compare the statistical differences between the different ages and sexes, a t test was used. A P value < 0.05 was considered to indicate statistical significance.