Cell culture
Alveolar epithelial cells type II (A549, ATCC) were maintained in DMEM medium supplemented with 10% FBS (Sigma), 2mM glutamine and 100U/mL of penicillin and streptomycin (Lonza). We used the active form of vitamin D (1α,25-Dihydroxyvitamin D3 or calcitriol) (cat.#D1530; Sigma-Aldrich; Vitamin D stock was 10 μM in ethanol) and the following vitamin D analogs (stocks were 50 μM in ethanol): calcipotriol (cat.#203537; Santa Cruz Biotechnology), paricalcitol (cat.#477938; Santa Cruz Biotechnology), tacalcitol (cat.#sc-361371a; Santa Cruz Biotechnology), 22-Oxacalcitriol (cat.#sc-361076; Santa Cruz Biotechnology) and vitamin D2 (cat.#sc- sc-205988; Santa Cruz Biotechnology). Treatments were performed in cells maintained in DMEM supplemented with 10% hormone-depleted serum. This serum was prepared by using the anion exchange resin AGR1-X8 from BIO-RAD (cat.#1401441) as previously described (22). Bleomycin sulfate (cat.# CAYM13877–50) was purchased to VWR (Bleomycin stock: 50 mM in PBS).
Maintenance of hESCs
The hESCs line AND-2 was obtained from the "Biobanco de células madre de Granada" (ISCIII, Spain); passages 26-40. Mouse embryonic fibroblasts (MEFs) were obtained at 13.5 days post-coitum from C57BL/6 mice as described previously (22). MEFs were mitotically inactivated by an overnight treatment with 2 µg/mL of mitomycin C (cat.#M4287; Sigma-Aldrich) and plated at a density of approximately 16000 cells/cm2. hESCs were cultured along with MEFs under standard conditions (http://www.stembook.org). The maintenance medium was composed of KO-DMEM (cat.#10829-018 Gibco; Life Technologies), 20% KO serum replacement (cat.#10828010 Gibco; Life Technologies), 0,1 mM β-mercaptoethanol (cat.#21985-023 Gibco; Life Technologies), 2 mM Glutamax (cat.#35050-061,Gibco; Life Technologies), nonessential aminoacids (cat.#11140-050 Gibco; Life Technologies and primocin (cat.#12I05MM; InvivoGen). The medium was filtered by using 0,22-µ pore filter systems (cat.#431097; Corning); 10 ng/mL recombinant human basic Fibroblast Growth Factor (hbFGF) (cat.#PHG6015; Invitrogen) and 10 µM Y-27632 (cat.#1254; Tocris R&D Systems) were added before use. The medium was changed in a daily basis and cells were passaged either by enzymatic (collagenase IV method) (collagenase IV: cat.#11140050; Gibco; Life Technologies) or mechanical procedures (http://stembook.org). Cells were maintained in an undifferentiated state in a 5% CO2/air environment. The differentiation process was carried-out in a 5% CO2/5% O2/95% N2 environment [Galaxy 48R incubator (New Brunswick)], unless otherwise indicated.
Primitive streak formation and induction of definitive endoderm (DE)
Induction of endoderm was performed as previously described (Magro-Lopez et al., 2018, 2017). Primitive streak formation (day 0; 24h) and endoderm induction (days 1-4) were performed in serum-free differentiation (SFD) medium. SFD medium was composed of a mix of IMDM:F12 (3:1) media (cats.#B12-722F and 10-080 CVR; Corning), supplemented with N2 (cat.#17502-048, Gibco; Life Technologies), B27 (cat.#17504-044, Gibco; Life Technologies), 2 mM Glutamax (cat.#35050-061 Gibco; Life Technologies), 1% penicillin-streptomycin (DE17-602E; Lonza), and 0.05% bovine serum albumin (BSA) (cat.#A7906; Sigma-Aldrich). The medium was filtered using a 0.22 µ-pore filter system (cat.#431097; Corning); 50 μg/mL ascorbic acid (cat.#A4554; SigmaAldrich) and 0.04 μL/mL monothioglycerol (stock >97%) (cat.#M6145; Sigma-Aldrich) were added before use. MEFs were depleted by passaging hESCs lines onto MatrigelTM-coated (cat.#354230; Life Technologies) plates for at least 48h. Cells were briefly trypsinized into small 3-10 cell clumps and the reaction was halted with stop medium [IMDM medium (BE12722F) supplemented with 50% foetal bovine serum (F7524, Sigma-Aldrich), 2 mM Glutamax, 1% penicillin-streptomycin and 30 ng/mL DNase I (cat.#260913-10MU; Calbiochem)]. Cells were then centrifuged 5 min at 850 rpm and washed carefully two times with an excess of SFD medium. To form embryoid bodies (EBs), the clumps were plated onto low-attachment 6-well plates (cat.#3471; Corning) and maintained in SFD medium in a 5% CO2/5% O2/95% N2 environment (Galaxy 48R incubator; New Brunswick).
For primitive streak formation, 10 μM Y-27632, 10 ng/mL Wnt3a (cat.#5036-WN; R&D Systems) and 3 ng/mL human BMP4 (cat.#314-BP; R&D Systems) were used. EBs were collected, resuspended carefully in endoderm induction medium containing 10 μM Y-27632, 0.5 ng/mL human BMP4, 2.5 ng/mL hbFGF, and 100 ng/mL human Activin (cat.# 338-AC; R&D Systems). Cells were fed after 36–48 h, depending on cell density, by removing half the old medium and adding half fresh medium.
Induction of anterior foregut endoderm (AFE)
AFE (days 4, 5 or 5) was induced as previously described (Magro-Lopez et al., 2018, 2017). EBs were dissociated into single cells with trypsin. Dissociated cells were transferred to a conical tube containing stop medium to neutralize trypsin. Cells were centrifuged for 5 min at 850 rpm, washed carefully twice with SFD medium and counted. For AFE induction, 25.000-30.000 cells/cm2 were plated on fibronectin– coated (F0895; Sigma-Aldrich) 12-well tissue culture plates in AFE induction medium 1 [SFD medium supplemented with 10 mM SB-431542 (cat.#1614; Tocris) and 100 ng/mL of NOGGIN (cat.#6057;, R&D Systems). After 24h of incubation, the medium was aspirated and AFE induction medium 2 [SFD medium supplemented with 1 µM IWP2 (cat.#3533; Tocris) and 10 µM of SB-431542] was added to the cultures. This process was carried out under hypoxic conditions only for bidimensional cultures.
Lung progenitors induction and expansion
Lung progenitor induction and expansion was carried out as previously described (Magro-Lopez et al., 2018, 2017). On day 6,5-7, AFE cultures treated for 20 days with the ventralization medium consisting of SFD medium supplemented with 3 µM CHIR99021 (cat.#04; Tocris), 10 ng/mL human FGF10 (cat.#345-FG; R&D Systems), 10 ng/mL human KGF (cat.#251KG-010; R&D Systems), 10 ng/mL human BMP4 (cat.#314-BP; R&D Systems), 10 ng/mL murine EGF (cat.#2028-EG-200; R&D Systems) and 50 nM all-trans retinoic acid (cat.#R2625; Sigma-Aldrich). Culture medium was changed every two days. At a time point between days 8 to 12 cultures were incubated under normoxic conditions. At day 16, cultures were briefly digested with trypsin in order to remove potential nonectodermal contaminating cells. Supernatant of this brief digestion containing single cells and small clumps were removed. The remaining cell clumps were replated onto fibronectin-coated MW12 plates at 1:3 dilutions in fresh medium after trypsin neutralization and careful washing. Plates were returned to the hypoxic conditions (5% CO2/5%O2/95%N2 environment).
Lung and airway epithelial cells maturation
At day 26 cultures were incubated with SFD medium supplemented with 3 µM CHIR99021, 10 ng/mL human FGF10, 10 ng/mL human FGF10, 0,1 mM 8-bromocAMP (cat.# B5386; Sigma-Aldrich), 0,1 mM IBMX (3,7-dihydro-1-methyl-3-(2methylpropyl)-1H-purine-2,6-dione; cat.# I5879; Sigma-Aldrich)) and 60 nM dexamethasone (cat.#D5902; Sigma-Aldrich). The medium was changed every two days and plates were maintained under conditions (5%CO2/5%O2/95%N2 environment). Cultures were carried further in these conditions until their experimental use at day 50. Treatments were performed in minilungs maintained in day 26 medium as indicated in the corresponding experiments.
Formation of lung bud organoids
In this case, the differentiation process was performed under normoxic conditions from the anteriorization stage on. At day 8, cells were briefly trypsinized into small 3–10 cell clumps and the reaction was halted with stop medium (IMDM medium (BE12-722F) supplemented with 50% fetal bovine serum (FBS; F7524; Sigma-Aldrich), 2 mM Glutamax, 1% penicillin-streptomycin). Cells were then centrifuged for 5min at 850 rpm and washed carefully twice with an excess of SFD medium. The clumps were plated onto low-attachment six-well plates (cat.#3471; Corning) in branching medium (SFD medium containing 3 μM CHIR99021, 10 ng/mL FGF10, 10 ng/mL KGF, 10 ng/mL BMP4, 50 nM all-trans retinoic acid). These three-dimensional clumps (nascent lung bud organoids) were incubated and fed every other day for approximately 20–25 days. After that, these nascent organoids were embedded into a MatrigelTM sandwich assembled on MW96 wells. 50 μL of MatrigelTM was loaded on the MW96 well and allowed to gel. Nascent organoids were picked up with a wide mouth plastic Pasteur pipette, divided into MW96 wells containing 50% MatrigelTM, diluted in branching media and immediately transferred onto the first layer of MatrigelTM. After solidification of this intermediate layer containing the nascent organoids, 50 μLMatrigelTM was added on top. Finally, each sandwich containing various organoids was incubated with 50 μL branching media. Medium was changed every 2–3 days. Growing branching structures were easily visualized under the microscope after 1 or 2 weeks. Treatments were performed in minilungs maintained in branching medium as indicated in the corresponding experiments.
Indirect immunofluorescence of A549 cells and 2D minilungs
Cells were seeded in 8-well chambers (cat.#154,534; Thermofisher Scientific) at a density of 20.000 cells/well. The following day the cells were treated as indicated in the corresponding experiments. Immunofluorescence was performed as previously described (Zambrano et al., 2014). Basically, cells were fixed in 2% PFA in PBS for 10min at RT and permeabilized with 0.1% Triton X-100 and 0.1% sodium citrate for 5min at RT. Preparations were washed with PBS and washing solution (PBS/0.25% BSA/0.1% Tween 20), blocked for 30 min with blocking solution (washing solution + 2.5% BSA), and incubated overnight with antibodies against TP53BP1(1:500; sc-16565; Invitrogen). Preparations were then washed with washing solution and incubated with secondary antibodies conjugated with alexa fluor dyes (488, 546) from Life Technologies (cat.#A-11029, cat.#A-11035) for 1h at RT. Nuclei were counterstained with DAPI, and samples were mounted with ProLong Diamond (cat.#P36961; Life Technologies). Cell images were captured with a fluorescence microscopy (Zeiss Axio) equipped with a camera (AxiocamMRm) and AxioVision software. DNA damage foci were quantified by counting from >150 cells for each experimental condition. For 2D minilungs, the glass chamber slides were incubated overnight at 4ºC with human fibronectin in order to plate the differentiated cells. Cultures from day 50 were digested with trypsin, neutralized with stop medium and washed with SFD medium. Approximately 40.000 differentiated epithelial cells per well were plated in the epithelial maturation medium. Cultures were maintained in normoxic conditions for one day before treatments.
Indirect immunofluorescence of lung bud organoids
Organoids were picked up from the MW96 wells, transferred into a well of a MW12 and fixed with 4% paraformaldehyde (PFA) for 15 min at RT. After that, the organoids were washed three times with PBS for 10 min and incubated overnight at 4°C with 30% sucrose. The sucrose was exchanged for a solution of 7.5% gelatin/15% sucrose and incubated for 15 min at 37°C. The organoids were carefully transferred to cryomolds and progressively embedded in various layers of solidified 7.5% gelatin/15% sucrose. These preparations were cut into 10-μm sections in a Leica CM3050 cryostat. The mounted sections were washed with PBS and permeabilized with PBS/1% BSA/0.25% Triton X-100 for 5 min at RT. After that, the sections were washed and blocked for 30min at RT with blocking solution (PBS-BSA 1%). The sections were incubated for 2h with antibodies against TP53BP1 (1:500; sc-16565; Invitrogen) or the pro surfactant protein C (1:200; ab3785, Merck). Preparations were washed with washing solution and incubated with a secondary antibody conjugated with Alexa fluor dye (546) from Life Technologies (cat.#A-11035) for 1h at room temperature. Nuclei were counterstained with DAPI and samples were mounted with ProLong Diamond (cat.#P36961; Life Technologies). Cell images were captured with a fluorescence microscopy (Zeiss Axio) equipped with a camera (AxiocamMRm) and AxioVision software. DNA damage foci were counted from >150 cells for each experimental condition.
Analysis of proteins by western-blot
Cell monolayers were washed with ice-cold PBS and lysed in triple-detergent lysis buffer [50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 100 μg/ml PMSF, 2 μg/ml pepstatin, 2 μg/ml aprotinin, 2 μg/ml leupeptin, and phosphatase inhibitors cocktail 2 or 3 (cat.#P5726, P0044, Sigma-Aldrich)]. SDS-PAGE and immunoblotting were performed under standard conditions. Basically, samples in Laemmli buffer (30 μg/lane) were separated through 12% gels and transferred to nitrocellulose membranes for 90 min at RT in the presence of 20% methanol and 0,1% SDS. Membranes were blocked with 3% BSA in PBS-Tween 0,05% (PBST-BSA) and incubated O/N at 4 °C with a γH2AFX antibody (cat.#05–636, Millipore) diluted 1:1000 in PBST-BSA. Densitometry analysis of bands was performed by using Image J software (https://imageJ.nih.gov/)
Quantitative real-time RT-PCR (RT-qPCR) of minilungs
Total RNA was extracted using Trizol (cat.#15596026; Ambion) following manufacturer’s instructions. cDNA was generated using the High-Capacity cDNA kit (cat.#4387406; Applied Biosystems). Real-time qPCR was performed by using the powerUpSYBR Green mix (cat.#A25742) on the Quantstudio-3 system (Applied Biosystems) following manufacturer’s instructions. Absolute quantification of each gene was obtained using a standard curve of serial diluted genomic DNA (cat.#11807720, Roche) and normalized to housekeeping gene TBP (Tata Box Binding protein)
The genes analyzed and the sequences of the oligonucleotides employed in this study, were the following: TBP [Tata-Box Binding Protein; Forward: 5’-TGAGTTGCTCATACCGTGCTGCTA, Reverse: 5’- CCCTCAAACCAACTTGTCAACAGC]; TP63 (Tumor Protein P63, marker of basal cells) [Forward: 5’-CCTATAACACAGACCACGCGCAGA, Reverse: 5’-GTGATGGAGAGAGAGCATCGAAG]; MUCIN5AC (Mucin 5AC, marker of globet cells ) [Forward: 5’GCACCAACGACAGGAAGGATGAG, Reverse: 5’-CACGTTCCAGAGCCGGACAT]; SCGB1A1 (Secretoglobin Family1A Member1 or CC10, marker of clara cells) [Forward: 5’-TCATGGACACACCCTCCAGTTATGAG,
Reverse: 5’-TGAGCTTAATGATGCTTTCTCTGGGC]; PDPN (Podoplanin, marker of AT-I cells) [Forward: 5’- AGGAGAGCAACAACTCAACGGGA, Reverse: 5’- TTCTGCCAGGACCCAGAGC]; AQP5 (Aquaporin 5, marker of AT-I cells) [Forward: 5’- GCCATCCTTTACTTCTACCTGCTC, Reverse: 5’- GCTCATACGTGCCTTTGATGATGG]; SFTPA (Surfactant Protein A, marker of AT-II cells) [Forward: 5’-GTGCGAAGTGAAGGACGTTTGTG, Reverse: 5’-TTTGAGACCATCTCTCCCGTCCC]; SFTPB (Surfactant Protein B, marker of AT-II cells) [Forward: 5’-TCTGAGTGCCACCTCTGCATGT, Reverse: 5’-TGGAGCATTGCCTGTGGTATGG]; SFTPC (Surfactant Protein C, marker of AT-II cells) [Forward: 5’-CCTTCTTATCGTGGTGGTGGTGGT, Reverse: 5’-TCTCCGTGTGTTTCTGGCTCATGT]; SFTPD (Surfactant Protein D, marker of AT-II cells) [Forward: 5’-TGACTGATTCCAAGACAGAGGGCA, Reverse: 5’-TCCACAAGCCCTGTCATTCCACTT]; FOXJ1 (Forkhead Box J1, marker of ciliated cells) [Forward: 5’-GGCATAAGCGCAAACAGCCG, Reverse: 5’-TCGAAGATGGCCTCCCAGTCAAA]
Statistical analysis
Data were subjected to the Shapiro-Wilk test and D’Agostino and Pearson omnibus test to verify their normality. Statistical significance of data was determined by applying a two-tailed Student’s t test or analysis of variance followed by the Newman–Keuls or Bonferroni post-tests for experiments with more than two experimental groups. P <0.05 is considered significant. Significance of analysis of variance post-test or the Student’s t test is indicated in the figures as *, P < 0.05; **, P <0.01; and ***, P < 0.001. Statistics were calculated with the Prism 7 software (GraphPad Software). The results presented in the figures are means ±SEM. Experiments were repeated three times.