Samples
The serum of 50 Chinese women with PCOS was collected in Mindong hospital, Ningde City, Fujian Province from September 2018 to December 2018. According to the revised PCOS diagnostic criteria published by the Rotterdam consensus [1], the PCOS group excluded patients with Cushing's syndrome, delayed congenital adrenal hyperplasia, thyroid dysfunction / hyperthyroidism, hyperprolactinemia or androgen secreting tumor, as well as patients with diabetes, hypertension, chronic kidney disease, smoking and using alcohol or drugs. The serum of 50 healthy women was collected as the control group. The volunteers in the control group had normal menstruation, normal ovaries and no history of reproductive system disease or appendicitis. The control group did not take any medications in the past 3 months, including oral contraceptives or other hormonal medications with no intrauterine devices or smoking. Patients with reproductive system disease or appendicitis history were excluded from the control group. All volunteers had understood the purpose and requirements of this study and signed a written informed consent before participating in the study. 4 ml of elbow venous blood from each sample was taken and stored in a refrigerator at -80 °C. All the experiments involved in this study have obtained the ethical approval of Mindong hospital in Ningde City
Evaluation of BMI and sex hormone
The weight and height of the volunteers were measured to calculate Body mass index (BMI) (BMI=weight/height2). Radioimmunoassay (RigorBio Scientific and Technology Co., Beijing) was used to measure the level of total testosterone and other sex hormones.
Cell line and transfection
Human ovarian granulosa cell lines kgn, cov434 and svog were purchased from cell resource bank of Chinese Academy of Sciences. 1×105 cells were seeded into 24 well plates. Mir-23a micmic, miR-23a inhibitor and negative control (NC, mimic NC and inhibitor NC) (Ruibo Biotechnology Co., Ltd, Guangzhou, China) were transfected into cov434 cells by LipofectamineTM 2000. Normal untreated cov434 cells were cultured as control. The sequence of siRNA used in this study is as follows: miR-23a mimic, 5’-CCTTTAGGGACCGTTACACTA-3’; mimic NC, 5’-TTCTCCGAACGTGTCACGTTTC-3’; miR-23a inhibitor, 5’-TAGTGTAACGGTCCCTAAAGG-3’; inhibitor NC, 5’-TTCTCCGAACGTGTCACGTTTC-3’.
Real time fluorescence quantitative PCR (qPCR)
Total RNA were extract from samples or cells using Trizol reagent. Related expression of target gene was calculated using 2-ΔΔCt method. This study involves the following sequences: miR-23a Reverse transcription: 5’- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAAAT-3’; U6 Reverse transcription, 5’-AAAATATGGAACGCTTCACGAATTTG-3’; miR-23a forward primer 5’-GCGATCACATTGCCAGGG-3’ and reverse primer 5’-AGTGCAGGGTCCGAGGTATT-3’; U6 forward primer 5’-CTCGCTTCGGCAGCACATATACT-3’ and reverse primer 5’-ACGCTTCACGAATTTGCGTGTC-3’; FGD4 forward primer 5’-CCTGCCTCTGCTTCTTGTGTCTC-3’ and reverse primer 5’-TGGTTGTCAATCCATGCCTTCCTG-3’.
Cell proliferation assay
After 12 hours of transfection, cells were seeded into a 96 well plate at the density of 5×103 cells per well. Each group of cells was treated with 6 replicates. After incubation for the specified time (0, 12, 24, 48 and 72 h), 10 μl of CCK-8 reagent was added and incubated at 37 ℃ for 2 h. The absorbance of each pore was measured at 450 nm by an enzyme labeling instrument.
Flow cytometry analysis for cell cycle
After 48 hours of transfection, the cell cycle was detected by flow cytometry. The cells were fixed with 70% ethanol overnight at 4℃. The cells were resuspended with 500 μl of binding buffer. 50 μl PI was added to the cell suspension and incubated at room temperature for 30 min. The results were analyzed by ModFit and displayed by FL2-w and FL2-a.
Flow cytometry analysis for apoptosis
After 24 hours of transfection, the apoptotic cells were detected by flow cytometry. 2 μl of PI and FITC annein V were added into 100 μl cell suspension and incubated at room temperature for 10 min. Cell apoptosis was detected using a flow cytometer.
Western blot
The total protein was extracted with RIPA buffer. BCA method was used to detect the protein concentration. The extracted protein was electrophoresis by SDS-PAGE and transferred to PVDF membrane. PVDF membrane was incubated in 5% skimmed milk at room temperature for 1 h, and then primary antibody overnight at 4℃followed by the secondary antibody at room temperature for 2 h. QUANTITY ONE software is used for result analysis. The following antibodies were used in this research: anti-FGD4 (Abcam, ab97785, 1:2000, 87KDa);anti-CDC42 (Abcam, ab155940, 1:1000, 21KDa); anti-PAK1 (Abcam, ab223849, 1:1000, 60KDa) and β-actin (TransGen Biotech, HC201, 1:5000, 42KDa).
Double luciferase reporting assay
The plasmids of wild type (FDG4-WT) and mutant type (FDG4-MUT) luciferase reporter genes were constructed using pcDNA3.1as the empty vector. MiR-23a mimic, mimic NC, FDG4-WT and FDG4-MUT plasmids were co-transfected into cov434 cells by LipofectamineTM 2000. Cells were divided into four groups: FGD4-WT 3’-UTR + miR-23a mimic NC; FGD4-Mut 3’-UTR +miR-23a mimic NC; FGD4-WT 3’-UTR+ miR-23a mimic; FGD4-Mut 3’-UTR+ miR-23a mimic. After 36 h of transfection, Firely Lueiferase (F) and Renilla Luciferase (R) were detected by GLO-MAX 20/20 \fluorescence detector, and the relative luciferase activity (F / R) was calculated.
Statistical analyses
All data were analyzed with SPSS 22.0 (SPSS, Inc., Chicago, IL) software, and represented as mean ± SD. Spearman method was used to analyze the relationship between miRNA level and other indicators. Independent sample t-test was used to evaluate the difference between groups. P<0.05 was considered statistically significant.