Patient tissue specimens
Our study included two independent experimental cohorts. The first group included 35 cases of fresh frozen tumors and adjacent tissues selected from January to March 2018 in the First Hospital of Gastrointestinal Tumor Surgery affiliated to the China Medical University, performing quantitative real-time PCR (qRT-PCR) and Western blot analysis. The second group included 164 tissue samples from Gastrointestinal Cancer Surgery Department of the First Affiliated Hospital of China Medical University for radical gastrectomy from March 2009 to June 2012, performing immunohistochemistry for SKA3 and DUSP2. All included patients had a single lesion as confirmed by pathological verification and with complete postoperative follow-up data; the patients did not receive chemoradiotherapy before surgery. The study protocol was approved by the hospital ethics committee, and all patients signed informed consent.
Immunohistochemistry
After dewaxing and hydration, paraffin-embedded sections were immersed in 3% H2O2 solution for 20 min at 37°C to eliminate endogenous peroxidase followed by incubation in sodium citrate buffer (pH 6.0) at 121°C for 2 min. Sections were then incubated with primary antibodies against SKA3 (1:200, Abcam, Cambridge, MA, USA) and DUSP2 (1:200, Abcam) at 4°C overnight. Sections were then incubated with secondary antibodies at 37°C for 30 min and then stained with 3, 3-diaminobenzidine and counter-stained with hematoxylin for 1 min. Sections were dehydrated in gradient ethanol series followed by xylene. Samples were scored according to staining intensity and proportion of positive cells. Staining intensity was scored as follows: 0 for colorless, 1 for yellow, 2 for brown, and 3 for dark brown. The proportion of positive cells was scored as follows: < 5% was 0, 5%~25% was 1, 25%~50% was 2, 50%~75% was 3, and > 75% was 4. The final score was the product of the staining intensity and the proportion of positive cells scores; samples with scores ≥ 5 were considered positive and samples with scores ≤ 4 were negative.
Cell culture and transfection
The immortalized gastric epithelium cell line GES-1 and GC cell lines SGC-7901, MGC-803, HGC-27, and MKN-45 were purchased from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in DMEM and RPMI 1640 medium containing 10% serum. The human peritoneal mesothelial cell (HPMC) HMrSV5 was provided by Youming Peng (Second Hospital of Zhong nan University, Changsha, China) and cultured in RPMI 1640 medium containing 10% serum. Cells were cultured in an incubator at 37°C in 5% CO2.
SKA3 silencing lentiviruses (sh-SKA3), DUSP2 silencing lentiviruses (sh-DUSP2), DUSP2 overexpression lentiviruses (oe-DUSP2) and empty vector (control) were produced by Genechem (Shanghai, China). GC cells were seeded in 12-well plates and when cells achieved 60% to 70% confluence, an appropriate amount of virus was added according to the cell line MOI value. Stable infected cell lines were selected in 5 μg/mL purinomycin or neomycin. The sequences of sh-SKA3 are follows: sh-1, CTTATGAGAATCTGCTCAGAA and sh-2, GCATAGCTTTGGTATCCACAA. The sequence of sh-DUSP2 is CATCTGTCTGGCATACCTCAT and the control sequence is TTCTCCGAACGTGTCACGT.
Quantitative real-time PCR (qRT-PCR)
GC tissues and cells total RNA was extracted by Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was obtained by reverse transcription reaction using a reverse transcription kit (Takara, Tokyo, Japan), and the SYBR Premix Ex Taq ™ kit (Takara, Japan) was conducted qRT-PCR. The experiment was repeated three times. GAPDH mRNA was used as the internal reference gene. Data expression was determined by the −ΔΔCt method [17].
The primer sequences for qRT-PCR are as follows.
SKA3 forward: 5′-GCCATAGATACAGAATCCAGGCT-3′
SKA3 reverse: 5′-CCAAAGGAGAGTTGGTATATTCGG-3′
DUSP2 forward: 5′-TGTGGAGGACAACCAGATGGTG-3′
DUSP2 reverse: 5′-GAGGTATGCCAGACAGATGGTG-3′
GAPDH forward: 5′-GTCTCCTCTGACTTCAACAGCG-3′
GAPDH reverse: 5′-ACCACCCTGTTGCTGTAGCCAA-3′
Western blot
Total protein was collected from tissues and cells using lysis buffer. Samples were separated by SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. The membrane was blocked in a 5% skim milk for 1 h. The membrane was then incubated overnight at 4°C with primary antibody, followed by incubation in secondary antibody for 1 h. ECL luminescent solution was used to visualize protein bands. Antibodies against SKA3 (ab118560), DUSP2 (ab137640), GAPDH (ab181602) were purchased from Abcam and antibodies against E-cadherin (#14472), N-cadherin (#13116), Vimentin (#5741) Erk1/2 (#4695), and p-Erk1/2 (#4370) were from Cell Signaling Technology.
Co-immunoprecipitation
HGC-27 cell lysates were incubated with primary antibody (IgG as control) and A/G agarose beads at 4ºC for 6 h. After three washes with IP buffer, samples were analyzed by Western blot.
Cell proliferation and colony formation assay
Cell viability was measured using Cell Counting Kit-8 (CCK8, MedChemExpress, USA). GC cells were seeded at 2 × 103 cells/well in 96-well plates. After continuous culture for 24, 48, 72 and 96 h, 10 μl CCK8 solution was added to each well, and after incubation for 2 h, the absorbance value was measured at 450 nm using the Biotek microplate reader.
For clone formation assays, cells were seeded in 6-well plate (1×103 cells/well). After further culture for 14 days, the cells were fixed with paraformaldehyde for 20 min and stained with 0.4% trypan blue for 15 min for clone counting.
Flow cytometry
Cells collected by trypsinization were fixed overnight with 900 μl precooling 75% ethanol at 4ºC. Cells were then rinsed with PBS and then incubated in 300 μl propidium iodide staining solution at 37ºC for 30 min in the dark. Cell cycles were then analyzed by flow cytometry.
Wound-healing, cell migration and invasion assays
For wound-healing experiments, cells were uniformly seeded in a six-well plate. Once cells achieved 80% confluence, a 100 μl pipette tip was used to scratch the cells. The same field of vision was photographed under an inverted microscope at 0 h and 48 h after the scratch, and the scratch width was measured.
For migration experiments, a transwell chamber (8 μm, Corning, USA) was placed in a 24-well plate and cells were seeded into the upper chamber at a density of 2 × 104/well. Serum-free medium (100 μl) was added to the top well, and the lower chamber was filled with 600 μl medium containing 10% serum. After 16 h of culture, the transwell chamber was removed, fixed with paraformaldehyde, and stained with 0.4% trypan blue.
For invasion experiments, 90 μl of diluted matrigel (BD Biosciences, NJ, USA) was added to the upper chamber and then 2 × 104/well cells were also seeded into the upper chamber. The subsequent steps were the same as for the migration experiment.
Adhesion assay
HMrSV5 cells were seeded in a 12-well plate one day in advance and GC cells were seeded in a 6 cm diameter petri dish. Next, 2 μl Calcein-AM (Sigma, USA) was added to GC cells and cells were incubated in the dark for 1 h. Stained GC cells (1 ×104) were then added to each well of the plated HMrSV5 cells. The cells were incubated in the dark for 1 h and then washed. The number of GC cells that adhered to HPMCs was counted under a fluorescence microscope.
Animal experiments
All animal experiments were approved by the Ethics Committee of China Medical University and all operations were in accordance with animal ethics.
The subcutaneous tumor model was performed in 12 BALB/c immunodeficient nude mice (SPF level; 4–5 weeks old, female, and approximately 20 g in weight). The MGC-803 control group and the silence group were injected into 3 × 106 cells respectively in the left and right axillas of nude mice. Tumor volume was measured every three days. After 4 weeks, the subcutaneous tumors were dissected and weighed.
The intraperitoneal metastasis model was established in 20 BALB/c nude mice. Mice were assigned to two groups (n=10 per group), and 5×106 MGC-803 control or silent cells were injected into the abdominal cavity. After 6 weeks, mice were killed and dissected. The number of tumors on the peritoneal tissue was observed.
Statistical analysis
Statistical analysis was performed using SPSS 22.0 and GraphPad Prism 7.0. Experiments were repeated three times. Data are expressed as mean ± SD. The unpaired t test was used to compare the groups. The chi-square test was used to analyze the relationship between SKA3 expression and clinicopathological factors. The Pearson test was used to analyze the correlation between SKA3 and DUSP2 expression. Survival analysis was performed using the Kaplan–Meier method. Log-rank test calculated the survival differences among different groups and fitted the univariate and multivariate Cox proportional hazards model. P<0.05 was considered statistically significant.