miR-720 Regulates Insulin Secretion by Targeting Rab35

doi:10.21203/rs.3.rs-103727/v1

Download PDF

Research

miR-720 Regulates Insulin Secretion by Targeting Rab35

https://doi.org/10.21203/rs.3.rs-103727/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: miRNAs pose a good prospect in the diagnosis and treatment of type 2 diabetes (T2D). This study aimed to investigate whether miR-720 targets Rab35 to regulate insulin secretion in MIN6 cells and its molecular mechanism, and the clinical value of miR-720 as a specific biomarker of T2D.

Methods: Fifty-five samples of new diagnosis T2D patients and normal control were collected. Levels of miR-720, fasting blood glucose, insulin and other indicators of glucose and lipid metabolism were determined. We increased and decreased miR-720 expression using miR-720 mimic and inhibitor to identify the effect of miR-720 on insulin secretion in MIN6 cells, respectively. Then we used miR-720 mimic, miR-720 inhibitor and dual luciferase reporter gene assays to prove miR-720 regulate insulin secretion by targeting Rab35 in MIN6 cells. In addition, we overexpressed and silenced of Rab35 gene to detect the expression of PI3K, Akt and mTOR in MIN6 cells by RT-PCR and western blot.

Results: Circulating miR-720 was significantly higher in T2D group than control group, and miR-270 was positive correlated with fasting blood glucose, while negatively correlated with insulin. Overexpression of miR-720 inhibited insulin secretion and miR-720 downregulation promoted insulin secretion. miR-720 regulated insulin secretion by targeting Rab35 in MIN6 cells. Compared with the control group, the expression of PI3K, Akt and mTOR was significantly decreased by overexpression of Rab35 gene, while silencing Rab35 gene could induce the expression of PI3K, Akt and mTOR.

Conclusions: We conclude that miR-720 may as a potential biomarker for the diagnosis of T2D. Increase of miR-720 reduced Rab35 expression then activate PI3K/Akt/mTOR signal pathway, thus inhibiting insulin secretion.

Health Economics & Outcomes Research

miR-720

Rab35

insulin secretion

type 2 diabetes

biomarker

pancreatic β cells

Type 2 diabetes (T2D) is a homeostasis disorder of glucose metabolism caused by insulin resistance (IR) and/or pancreatic β-cells dysfunction, which involves the interaction of genetic, environmental and behavioral factors^{(1, 2)}. Previous studies on the pathogenesis of T2D mainly focused on pancreatic β-cells function and insulin secretion regulation. However, recent studies have confirmed that epigenetic mechanisms play an important role in the pathophysiological process of T2D ⁽³⁾.

microRNA (miR) is a highly conserved non-coding small RNA widely distributed in eukaryotic cells, 18–25 nucleotides long, being capable of affecting the biological functions of other genes by binding to the 3’UTR end of its target gene ^{(4, 5)}. More and more evidences ^(6–8) show that miRNAs are involved in the regulation of glucose metabolism, insulin synthesis and secretion, which are the core links in the development of T2D. There is no doubt that miRNAs provide new molecular clues for the pathological study of T2D, and miRNAs are expected to be specific diagnostic markers and therapeutic targets for T2D ^{(9, 10)}. miR-720 has been widely studied since its discovery, which is closely related to the pathophysiological process of various tumors. For example, the expression of miR-720 was decreased in breast cancer, and it was associated with lymph node metastasis ⁽¹¹⁾. The expression of miR-720 increased in cervical cancer ⁽¹²⁾. In colorectal cancer, the expression level of miR-720 in tumor tissues is higher than that in normal tissues ⁽¹³⁾. Compared with healthy people, the expression of miR-720 in serum of colorectal cancer patients was significantly increased, and its expression level was related to male gender and lymph node metastasis of colorectal cancer patients. Some studies suggest that miR-720 may be a prognostic marker for these specific types of cancer⁽¹⁴⁾. The research on miR-720 in T2D is still very limited yet.

Rab proteins are known to be important participants in insulin secretion by pancreatic β cells. Rab functions are accompanied by cyclical activation and inactivation of GTP-bound and GDP-bound forms between the cytosol and plasma membrane that are regulated by upstream regulators ⁽¹⁵⁾. In our previous study⁽¹⁶⁾, we found that Rab35 is closely related to the insulin secretion in pancreatic β cells, and Rab35 might be the target of miR-720 in pancreatic β cells.

Therefore, the aim of the current study was to investigate whether miR-720 targets Rab35 to regulate insulin secretion in MIN6 cells and its molecular mechanism, and the clinical value of miR-720 as a specific biomarker of T2D. The results are expected to obtain reliable evidence that miR-720 regulates insulin secretion, and provide a scientific basis for the application of miR-720 and its target as a new diagnostic index and treatment of T2D.

Ethical compliance

This study was approved by the Ethics Committee of The First Affiliated Hospital of Jinan University, and written informed consents were provided by all the participants.

Experimental materials and reagents

All the participants were recruited from the first affiliated hospital of Jinan University between January 2019 and July 2020 who were further classified into two groups: healthy control group and T2D group.

T2D was confirmed in accordance with the World Health Organization (WHO) criteria ⁽¹⁷⁾: fasting blood glucose (FG) levels ≥ 7.0 mmol/L, or a 2-hour oral glucose tolerance test (OGTT) ≥ 11.1 mmol/L in the presence of symptoms and glycated hemoglobin (HbA1c) levels > 6.5%. The 50 T2D patients were diagnosed for the first time, and no diabetes drugs were used before the diagnosis. Exclusion criteria: patients with other severe malnutrition; long-term use of glucocorticoids and other hormone drugs; patients with severe heart, liver and kidney dysfunction; patients with severe pneumonia, nephritis and other systemic infectious diseases.

Reverse transcription polymerase chain reaction (RT-PCR)

About 10 ml venous blood was extracted and totals RNA was isolated using PAXgene Blood miRNA Kit (Qiagen) according to the manufacturer's recommendation. ABgene Reverse-iT One-Step RT-PCR Kit (ReadyMix Version) and a Mastercycler gradient. thermocycler (Eppendorf, Germany) using the following primers for: miR-720 primers (forward primer, GCGTGCTCTCGCTGGGG; reverse primer, GTGCAGGGTCCGAGGT); PI3K primers (forward primer, AGCAGGTACCCTGGTGATTG; reverse primer, AGAAGGCACAGGTCCAGAGA); Akt primers (forward primer, ACTCATTCCAGACCCACGAC; reverse primer, CCGGTACACCACGTTCTTCT); mTOR primers (forward primer, GGGCAGCAACAGTGAAAGTG; reverse primer, ACGGAAGAAGCCTTGGACAG); β-actin primers (forward primer, AAATCTGGCACCACACCTTC; reverse primer, GGGGTGTTGAAGGTCTCAAA) were synthesized ⁽¹⁸⁾.

Western blotting

Western blot analysis was performed as described previously ⁽⁵⁾. Briefly, proteins were separated using SDS-PAGE and electrophoretically transferred to polyvinylidene difluoride membranes. The membranes were blocked in Tris-buffered saline with 5% milk and 0.05% Tween and incubated overnight at 4 °C with primary antibodies including rabbit anti-Rab35 (1:1000, USA), rabbit anti-PI3K (Abcam), rabbit anti-Akt (Abcam), rabbit anti-mTOR (Abcam), rabbit anti-GFP (Abcam) and rabbit anti-PTPRN2 antibodies (Sigma). After being washed 3–5 times with TBST, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibodies (Jackson ImmunoResearch) and visualized using enhanced chemiluminescence reagents.

Cell Line and Culture

The mouse insulinoma cell line MIN6 was obtained from BoGu Biotechnology Co. Ltd.(Shanghai, China). High-glucose (4500 mg/L) Dulbecco’s modified Eagle’s medium (DMEM) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Fetal bovine serum (FBS) was purchased from Biological Industries (Cromwell, CT, USA). The MIN6 cells were maintained in high-glucose DMEM supplemented with 12% FBS, 10 µl/L β-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA), 100 U/ml penicillin, and 100 µg streptomycin mixture (Solarbio, Beijing, China) at 37 °C in 5% CO₂.

Insulin Enzyme-linked immunosorbent assay (ELISA)

After transfection for 48 h, supernatants from MIN6 cells were assayed for insulin. Insulin was quantified according to the manufacturer’s protocol using 96-well plates and an Insulin Mouse ELISA Kit (catalog# EMINS, Invitrogen Corporation, CA).

Statistical analysis

Results were shown as mean ± standard deviation (SD). The statistical analysis was performed using the SPSS 18.0 (SPSS Inc., Chicago, Illinois) and the data were visualized using the GraphPad 7. The independent t test was employed for comparison between two groups. The correlation between miR-720 and FBG, and miR-720 and FINS were assessed by one-way ANOVA, followed by Fisher’s least significant difference test. Two-tailed P-values < 0.05 were considered statistically significant.

Clinical characteristics of the subjects

Fifty healthy control subjects and 50 T2D subjects were enrolled and the relevant clinical data were shown in Table 1. Gender and age distribution showed no statistical difference ( P > 0.05) in two groups, whereas body mass index (BMI), FBG, c peptide (C-P), fasting insulin (FINS), HbA1c, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), total cholesterol (TC) and triglyceride (TG) differed significantly in T2D group when compared with healthy control group.

Table 1

General information of T2D patients and control group
Factors	T2D group	Control group
Gender (M/F)	50 (24/26)	50 (27/23)
Age (years)	57 ± 8.2	55 ± 7.8
BMI (kg/m²)	26.2 ± 4.1**	23.1 ± 3.8
FBG (mmol/L)	13.68 ± 2.81**	4.96 ± 0.86
C-P (ng/ml)	2.52 ± 0.77*	2.09 ± 0.72
FINS (mU/L)	13.15 ± 5.47*	10.12 ± 6.41
HbA1c (%)	9.89 ± 2.74**	3.21 ± 1.27
LDL-C (mmol/L)	3.28 ± 0.37**	2.38 ± 0.68
HDL-C (mmol/L)	1.18 ± 0.61*	1.37 ± 0.34
TC (mmol/L)	4.70 ± 0.52**	4.12 ± 0.85
TG (mmol/L)	2.49 ± 1.06**	1.50 ± 0.58
Note: Data are presented as number (percentage) for categorical data or mean ± standard deviation (SD) for parametrically distributed data.
Abbreviations: BMI, body mass index; T2D, type 2 diabetes; FBG, fasting blood glucose; C-P, c peptide; FINS, fasting insulin; HbA1c, hemoglobin A1c; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TC, total cholesterol; TG, triglyceride.
: P <* 0.05 compared to control group
**: P < 0.01 compared to control group.

Circulating miR-720 in type 2 diabetes

Circulating miR-720 was significantly higher in T2D group compared with control group (Fig. 1A). There was a positive correlation between circulating miR-720 and FBG (Fig. 1B). The expression of miR-720 was negatively correlated with FINS (Fig. 1C). These results suggested that the secretion of miR-720 is closely related to T2D events.

miR-720 effects on insulin secretion in MIN6 Cells

To identify the effect of miR-720 on insulin secretion in MIN6 cells, we increased and decreased miR-720 expression using the miR-720 mimic and inhibitor, respectively, and detected the level of insulin secretion after stimulation with 5.7 and 16.7 mM glucose. The ELISA results showed that miR-720 overexpression inhibited insulin secretion under highglucose stimulation (P < 0.01) (Fig. 2A), and miR-720 downregulation promoted insulin secretion under highglucose stimulation (P < 0.01) (Fig. 2B). Regardless of whether miR-720 was up- or down-regulated, there was no effect on insulin secretion under basal-glucose stimulation (Figs. 2). These results indicated that miR-720 plays a negative regulatory role in GSIS, but not in insulin secretion at physiological blood glucose levels.

Rab35 is the target of miR-720

miR-720 mimic could down regulated Rab35 mRNA and protein expression in MIN6 Cells (Fig. 3A, 3B); miR-720 inhibitor could up regulated Rab35 mRNA and protein expression in MIN6 Cells (Fig. 3C, 3D). Relationship between miR-720 and its target Rab35 based on dual luciferase reporter gene assays. The results showed overexpression of miR-720 significantly inhibited the firefly luciferase activity of Rab35 wild type compared with miR-NC group (P < 0.05). However, there was no significant effect on the firefly luciferase activity of Rab35 mutant (Fig. 3E).

Subsequently, we wanted to investigate whether Rab35 had a negative effect on insulin secretion compared with miR-720 in MIN6 cells. Therefore, we constructed a miR-720 insensitive Rab35 expression vector (pcDNA3.0-Rab35). The vector only contains Rab35 coding sequence on the basis of pcdna3.0-vector to avoid the target of miR-720. Successful overexpression of Rab35 was evaluated by Western blot (Fig. 3F). Then, we analyzed the effect of Rab35 expression on insulin secretion in MIN6 cells. Compared with the control group transfected with empty vector pcdna3.0-vector, Rab35 overexpression promoted insulin secretion (Fig. 3G). The results suggest that Rab35 has an opposite effect on insulin secretion in MIN6 cells compared with miR-720, which further suggests that Rab35 may be a functional target of miR-720 in MIN6 cells. It was confirmed that miR-720 regulate insulin secretion by targeting Rab35 in MIN6 cells.

Rab35 regulates PI3K/AKT/mTOR signaling pathway

After overexpressed and silenced of Rab35 gene, the expression of PI3K/Akt/mTOR signaling pathway related molecules in MIN6 cells was detected by RT-PCR and Western blot respectively. The results showed that compared with the control group, the expression of PI3K, Akt and mTOR was significantly decreased by overexpression of Rab35 gene (Fig. 4A, 4B), while silencing Rab35 gene could induce the expression of PI3K, Akt and mTOR (Fig. 4C, 4D).

Circulating miRNAs have become ideal and non-invasive molecular markers to evaluate the pathophysiological status of various diseases due to their stable changes in diseases, stable existence in serum, plasma, urine, saliva and other body fluids, and easy to obtain and preserve clinically ⁽¹⁹⁾. According to some previous studies, the levels of miR-126, miR-15a and miR-223 in peripheral blood were decreased several years before the onset of T2D; compared with patients with diabetes mellitus (DM) and metabolic syndrome (MS), the serum levels of miR-9, miR-29, miR-30d, miR-34a, miR-124a, miR-146a and miR-375 were higher in newly diagnosed T2D patients ⁽²⁰⁾; compared with the control group, the serum levels of miR-375 and miR-9 were higher in patients with pre diabetes mellitus. These two miRNAs were directly related to the presence of pre diabetes and T2D, and miR-375 was independently related to the occurrence of T2D. miR-375 alone or combined with miR-9 can be used as early detection markers of pre diabetes and T2D ⁽²¹⁾. In addition, studies have shown that miR-378, miR-126-3p and miR-223 in blood are indicators of disease staging and prognosis in elderly patients with T2D ⁽²²⁾. In conclusion, serum miRNAs are noninvasive and ideal indicators for the diagnosis and prognosis of T2D ⁽²³⁾. However, no miRNA has been recognized as a specific diagnostic marker for T2D. In this study, we found that the serum miR-720 level of 50 newly diagnosed T2D patients was significantly higher than that of healthy control group (P < 0.05), and miR-720 was positively correlated with blood glucose level and negatively correlated with insulin level (P < 0.05). This suggests that miR-720 is highly expressed in T2D patients and is related to blood glucose and insulin levels. This suggests that miR-720 may reflect the disorder of glucose metabolism in T2D patients to a certain extent, and may become a potential biomarker for the diagnosis of T2D.

Insulin release from pancreatic β cells is a necessary condition for maintaining normal glucose homeostasis in humans and many other animals. miRNAs are known to be involved in the regulation of insulin signaling pathway, but the mechanism is still unclear. Therefore, it may have important clinical value to explore the mechanism of miRNAs regulating insulin secretion by pancreatic beta cells and to understand the significance of miRNAs in T2D. Evidence suggests that miRNAs, as key regulators of gene expression, play an important role in the production, transport and secretion of insulin. The change of miRNAs expression can lead to insulin secretion dysfunction and IR, destroy insulin signaling pathway and various physiological processes, and then lead to the occurrence and development of DM ⁽²⁴⁾. As a result, the potential role of miRNAs in the treatment of T2D has been widely concerned ^{(25, 26)}.

The production of insulin is the key function of pancreatic beta cells, and the release of insulin is necessary to maintain glucose homeostasis. Among the known miRNAs that play an important role in insulin secretion and glucose homeostasis, miR-375 is the most concerned ⁽²⁷⁾. Some studies suggest that miR-375 is an important regulator of pancreatic beta cells function ^{(28, 29)}; overexpression of miR-375 can reduce the number and viability of pancreatic beta cells ^{(29, 30)}. It can regulate the insulin secretion by directly targeting genes related to exocytosis ^{(28, 31)}. In addition, miR-103 and miR-107 can regulate insulin and glucose homeostasis in vivo. They play an important role in insulin sensitivity and may be potential targets for the treatment of T2D ⁽²⁰⁾. However, the mechanism of miR-720 in regulating insulin secretion by pancreatic beta cells is still unclear. Many studies have explored the function and target of miR-720 in disease progression. Known targets of miR-720 include TWIST1 in breast cancer ⁽¹¹⁾, Rab35 in cervical cancer ⁽¹²⁾, StarD13 in colorectal cancer ⁽¹³⁾ and CCND1 in pancreatic cancer ⁽¹⁴⁾.

Other studies have shown that miR-720 can negatively regulate p63 and promote epithelial development ⁽³²⁾; miR-720 participates in the control of human dental pulp cell stem cell phenotype by directly inhibiting NANOG’s level ⁽³³⁾; targeting miR-720 can help restore the immunity of patients with chronic hepatitis B ⁽³⁴⁾. Our study found that overexpression of miR-720 inhibited glucose stimulated insulin secretion in MIN6 cells, while down-regulation of miR-720 promoted insulin secretion. Subsequently, we found that Rab35 was the target of miR-720 in MIN6 cells by luciferase reporter gene.

Rab proteins are also known to be important participants in exocytosis and secretion of insulin by pancreatic β cells. Rab functions are accompanied by cyclical activation and inactivation of GTP-bound and GDP-bound forms between the cytosol and plasma membrane that are regulated by upstream regulators ^{(16, 35)}. In our previous study, we found that Rab35 is closely related to the exocytotic and secretory function of pancreatic β cells ⁽¹⁶⁾. PI3K/Akt/mTOR signaling pathway regulates the life activities of many kinds of cells, including cell growth, proliferation and differentiation. Over activation of PI3K/Akt/mTOR is involved in diabetic retinopathy, diabetic nephropathy and IR ⁽³⁶⁾. PI3K/Akt/mTOR is a signal pathway closely related to insulin signal transduction ^{(6, 24)}. The expression of PI3K and phosphorylation of Akt in kidney, liver, skeletal muscle and adipose tissue of DM rats were significantly decreased; in the development of DM, persistent hyperglycemia can promote the activation of PI3K / Akt signaling pathway, and ultimately accelerate the development of DM ⁽³⁷⁾. This study found that overexpression of Rab35 inhibited PI3K/Akt/mTOR signaling pathway and promoted insulin secretion; when Rab35 was inhibited, PI3K/ Akt/mTOR pathway was activated and insulin secretion was down regulated. Therefore, we speculate that Rab35 can regulate PI3K/Akt/mTOR signaling pathway and thus affect insulin secretion.

Insulin is the most important hormone regulating glucose metabolism in vivo, and the normal secretion of insulin can maintain the homeostasis of glucose metabolism ⁽³⁸⁾. Studies at home and abroad have confirmed that miRNAs can regulate insulin secretion and peripheral blood miRNAs can be used as biomarkers in the diagnosis and prognosis of T2D ⁽²¹⁾. However, the research on miR-720 in T2D is still very limited. Therefore, this research fills the gap in this field to a certain extent and has research significance. In conclusion, we conclude that miR-720 may become a potential biomarker for the diagnosis of T2D; the increase of miR-720 level can inhibit Rab35 protein expression and then activate PI3K/Akt/mTOR signal pathway related to insulin signal, thus inhibiting insulin secretion of pancreatic β cells (Fig. 5).

T2D: type 2 diabetes; IR: insulin resistance; miR: microRNA; FBG: fasting blood glucose; HbA1c: glycated hemoglobin; BMI: body mass index; C-P: c peptide; FINS: fasting insulin; LDL-C: low-density lipoprotein cholesterol; HDL-C: high-density lipoprotein cholesterol; TC: total cholesterol; TG: triglyceride; DM: diabetes mellitus; MS: metabolic syndrome

Ethical Approval and Consent to participate

All of the procedures were conducted according to the guidelines of the Medical Ethics Committees of the Health Bureau of the Guangdong Province of China. This study was approved by the Ethics Committee of the first affiliated hospital of Jinan University

Consent for publication

Not applicable.

Availability of supporting data

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This work was partly supported by the National Nature Science Foundation (No. 81804153), Guangdong Foundation for Basic and Applied Basic Research (No. 2019A1515110161), Fundamental Research for the Central Universities (No. 21619344) and Scientific Research Project of Guangdong Provincial Administration of Traditional Chinese Medicine (No. 20191090).

Authors' contributions

ZJL conceived and guided the research; DW and YLF analyzed the data; CTL wrote the manuscript and identified the research and editorial manuscript; LF reviewed manuscript. All authors read and confirmed the manuscript.

Acknowledgements

Not applicable.

Kahn SE, Cooper ME, Del Prato S. Pathophysiology and treatment of type 2 diabetes: perspectives on the past, present, and future. Lancet. 2014 Mar 22;383(9922):1068-83. PubMed PMID: 24315620. Pubmed Central PMCID: 4226760.
Czech MP. Insulin action and resistance in obesity and type 2 diabetes. Nature medicine. 2017 Jul 11;23(7):804-14. PubMed PMID: 28697184. Pubmed Central PMCID: 6048953.
Ruan Y, Lin N, Ma Q, Chen R, Zhang Z, Wen W, et al. Circulating LncRNAs Analysis in Patients with Type 2 Diabetes Reveals Novel Genes Influencing Glucose Metabolism and Islet beta-Cell Function. Cellular physiology and biochemistry. 2018;46(1):335-50. PubMed PMID: 29590649.
Liu M, Gong C, Xu RY, Chen Y, Wang XD. MicroRNA-5195-3p enhances the chemosensitivity of triple-negative breast cancer to paclitaxel by downregulating EIF4A2. Cell Mol Biol Lett. 2019 Jul 1;24. PubMed PMID: WOS:000473489300001. English.
Fei XX, Hu WB, Wang GS, Su CY, Huang XQ, Jiang ZJ. Effect of microRNA-143-3p-mediated CTNND1 on the biological function of lung cancer cells. Biocell. 2020;44(1):81-8. PubMed PMID: WOS:000520894300010. English.
Zhang BH, Shen CA, Zhu BW, An HY, Zheng AB, Xu SB, et al. Insight into miRNAs related with glucometabolic disorder. Biomed Pharmacother. 2019 Mar;111:657-65. PubMed PMID: WOS:000458737800072. English.
Miao CG, Zhang GX, Xie ZW, Chang J. MicroRNAs in the pathogenesis of type 2 diabetes: new research progress and future direction. Can J Physiol Pharm. 2018 Feb;96(2):103-12. PubMed PMID: WOS:000423976100001. English.
Tang X, Tang G, Ozcan S. Role of microRNAs in diabetes. Biochimica et biophysica acta. 2008 Nov;1779(11):697-701. PubMed PMID: 18655850. Pubmed Central PMCID: 2643014.
Rhodes CJ. Type 2 diabetes - A matter of beta-cell life and death? Science. 2005 Jan 21;307(5708):380-4. PubMed PMID: WOS:000226492300033. English.
Vatandoost N, Amini M, Iraj B, Momenzadeh S, Salehi R. Dysregulated miR-103 and miR-143 expression in peripheral blood mononuclear cells from induced prediabetes and type 2 diabetes rats. Gene. 2015 Nov 1;572(1):95-100. PubMed PMID: 26164754.
Li LZ, Zhang CZ, Liu LL, Yi C, Lu SX, Zhou X, et al. miR-720 inhibits tumor invasion and migration in breast cancer by targeting TWIST1. Carcinogenesis. 2014 Feb;35(2):469-78. PubMed PMID: 24085799.
Tang Y, Lin Y, Li C, Hu X, Liu Y, He M, et al. MicroRNA-720 promotes in vitro cell migration by targeting Rab35 expression in cervical cancer cells. Cell & bioscience. 2015;5:56. PubMed PMID: 26413265. Pubmed Central PMCID: 4583841.
Wang X, Kuang Y, Shen X, Zhou H, Chen Y, Han Y, et al. Evaluation of miR-720 prognostic significance in patients with colorectal cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2015 Feb;36(2):719-27. PubMed PMID: 25286763.
Zhang Y, Su Y, Zhao Y, Lv G, Luo Y. MicroRNA720 inhibits pancreatic cancer cell proliferation and invasion by directly targeting cyclin D1. Molecular medicine reports. 2017 Dec;16(6):9256-62. PubMed PMID: 28990111.
Klinkert K, Echard A. Rab35 GTPase: A Central Regulator of Phosphoinositides and F-actin in Endocytic Recycling and Beyond. Traffic. 2016 Oct;17(10):1063-77. PubMed PMID: WOS:000387236600001. English.
Chunting Lu QS, Lie Feng. The mechanism analysis of membrane fusion mediated exocytosis of pancreatic β-cells by Rab35 (in Chinese). The 17th National endocrinology conference of Chinese Medical Association. 2018;PU:07.
Zhao YC, Zhu J, Song GY, Li XS. Relationship between thioredoxin-interacting protein (TXNIP) and islet beta-cell dysfunction in patients with impaired glucose tolerance and hypertriglyceridemia. International journal of clinical and experimental medicine. 2015;8(3):4363-8. PubMed PMID: 26064354. Pubmed Central PMCID: 4443188.
Yuan Y, Peng W, Liu Y, Xu Z. Circulating miR-130 and its target PPAR-gamma may be potential biomarkers in patients of coronary artery disease with type 2 diabetes mellitus. Molecular genetics & genomic medicine. 2019 Sep;7(9):e909. PubMed PMID: 31368668. Pubmed Central PMCID: 6732310.
Kanak MA, Takita M, Shahbazov R, Lawrence MC, Chung WY, Dennison AR, et al. Evaluation of MicroRNA375 as a Novel Biomarker for Graft Damage in Clinical Islet Transplantation. Transplantation. 2015 Aug;99(8):1568-73. PubMed PMID: WOS:000369083800022. English.
Kong L, Zhu JJ, Han WX, Jiang XY, Xu M, Zhao Y, et al. Significance of serum microRNAs in pre-diabetes and newly diagnosed type 2 diabetes: a clinical study. Acta Diabetol. 2011 Mar;48(1):61-9. PubMed PMID: WOS:000288016800009. English.
Al-Muhtaresh HA, Al-Kafaji G. Evaluation of Two-Diabetes Related microRNAs Suitability as Earlier Blood Biomarkers for Detecting Prediabetes and type 2 Diabetes Mellitus. J Clin Med. 2018 Feb;7(2):12. PubMed PMID: WOS:000427522200002. English.
Catanzaro G, Besharat ZM, Chiacchiarini M, Abballe L, Sabato C, Vacca A, et al. Circulating MicroRNAs in Elderly Type 2 Diabetic Patients. Int J Endocrinol. 2018:e6872635. PubMed PMID: WOS:000430857800001. English.
Sharma S, Mathew AB, Chugh J. miRNAs: Nanomachines That Micromanage the Pathophysiology of Diabetes Mellitus. Advances in Clinical Chemistry. 2017;82:199-264. PubMed PMID: WOS:000413665400006. English.
Chakraborty C, Doss CG, Bandyopadhyay S, Agoramoorthy G. Influence of miRNA in insulin signaling pathway and insulin resistance: micro-molecules with a major role in type-2 diabetes. Wiley interdisciplinary reviews RNA. 2014 Sep-Oct;5(5):697-712. PubMed PMID: 24944010.
Lynn FC, Skewes-Cox P, Kosaka Y, McManus MT, Harfe BD, German MS. MicroRNA expression is required for pancreatic islet cell genesis in the mouse. Diabetes. 2007 Dec;56(12):2938-45. PubMed PMID: 17804764.
Sims EK, Lakhter AJ, Anderson-Baucum E, Kono T, Tong X, Evans-Molina C. MicroRNA 21 targets BCL2 mRNA to increase apoptosis in rat and human beta cells. Diabetologia. 2017 Jun;60(6):1057-65. PubMed PMID: 28280903. Pubmed Central PMCID: 5425307.
Landrier JF, Derghal A, Mounien L. MicroRNAs in Obesity and Related Metabolic Disorders. Cells-Basel. 2019 Aug;8(8):e859. PubMed PMID: WOS:000484537500092. English.
Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma XS, MacDonald PE, et al. A pancreatic islet-specific microRNA regulates insulin secretion. Nature. 2004 Nov 11;432(7014):226-30. PubMed PMID: WOS:000225020200048. English.
Poy MN, Hausser J, Trajkovski M, Braun M, Collins S, Rorsman P, et al. miR-375 maintains normal pancreatic alpha- and beta-cell mass. P Natl Acad Sci USA. 2009 Apr 7;106(14):5813-8. PubMed PMID: WOS:000264967500065. English.
El Ouaamari A, Baroukh N, Martens GA, Lebrun P, Pipeleers D, van Obberghen E. miR-375 targets 3'-phosphoinositide-dependent protein kinase-1 and regulates glucose-induced biological responses in pancreatic beta-cells. Diabetes. 2008 Oct;57(10):2708-17. PubMed PMID: 18591395. Pubmed Central PMCID: 2551681.
Tattikota SG, Sury MD, Rathjen T, Wessels HH, Pandey AK, You X, et al. Argonaute2 regulates the pancreatic beta-cell secretome. Molecular & cellular proteomics : MCP. 2013 May;12(5):1214-25. PubMed PMID: 23358505. Pubmed Central PMCID: 3650333.
Chikh A, Matin RN, Senatore V, Hufbauer M, Lavery D, Raimondi C, et al. iASPP/p63 autoregulatory feedback loop is required for the homeostasis of stratified epithelia. The EMBO journal. 2011 Sep 6;30(20):4261-73. PubMed PMID: 21897369. Pubmed Central PMCID: 3199390.
Hara ES, Ono M, Eguchi T, Kubota S, Pham HT, Sonoyama W, et al. miRNA-720 controls stem cell phenotype, proliferation and differentiation of human dental pulp cells. PloS one. 2013;8(12):e83545. PubMed PMID: 24386225. Pubmed Central PMCID: 3875457.
Wang Y, Zhang Z, Ji D, Chen GF, Feng X, Gong LL, et al. Regulation of T cell function by microRNA-720. Scientific reports. 2015 Jul 22;5:12159. PubMed PMID: 26199080. Pubmed Central PMCID: 4510490.
Shaughnessy R, Echard A. Rab35 GTPase and cancer: Linking membrane trafficking to tumorigenesis. Traffic. 2018;19(4):247-52.
Zhang C, Yoon MS, Chen J. Amino acid-sensing mTOR signaling is involved in modulation of lipolysis by chronic insulin treatment in adipocytes. American journal of physiology Endocrinology and metabolism. 2009 Apr;296(4):E862-8. PubMed PMID: 19190264. Pubmed Central PMCID: 2670623.
Wang C, Deng Y, Yue Y, Chen W, Zhang Y, Shi G, et al. Glutamine Enhances the Hypoglycemic Effect of Insulin in L6 Cells via Phosphatidylinositol-3-Kinase (PI3K)/Protein Kinase B (AKT)/Glucose Transporter 4 (GLUT4) Signaling Pathway. Medical science monitor : international medical journal of experimental and clinical research. 2018 Mar 1;24:1241-50. PubMed PMID: 29491345. Pubmed Central PMCID: 5842660.
Deacon CF. Therapeutic strategies based on glucagon-like peptide 1. Diabetes. 2004 Sep;53(9):2181-9. PubMed PMID: 15331525.

Download PDF

Version 1

posted

You are reading this latest preprint version

miR-720 Regulates Insulin Secretion by Targeting Rab35

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Ethical compliance

Experimental materials and reagents

Reverse transcription polymerase chain reaction (RT-PCR)

Western blotting

Cell Line and Culture

Insulin Enzyme-linked immunosorbent assay (ELISA)

Statistical analysis

Results

Clinical characteristics of the subjects

Circulating miR-720 in type 2 diabetes

miR-720 effects on insulin secretion in MIN6 Cells

Rab35 is the target of miR-720

Rab35 regulates PI3K/AKT/mTOR signaling pathway

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1