Animals
A total of 127 specific pathogen-free adult female Sprague–Dawley rats weighing 220–250 g (Jinan PengYue Laboratory Animal Breeding, Jinan, China) were used in experiments. All rats were housed in a separate environment under a 12-h light-dark cycle at 24 ± 2ºC, with 50% relative humidity. Food and water were available ad libitum. Experimental protocols for animals in this study were approved by the Animal Care and Use Committee of Binzhou Medical University. All animals were acclimatized to the new environment for at least 7 d before experiments.
Animal experiments were divided into two parts. Sprague–Dawley rats for Part 1 were randomized into three groups: control (n = 6), sham control (n = 6), and SCI (n = 30). Rats in the SCI group were sacrificed at 1, 3, 7, 14, and 28 dpi. Rats in Part 2 were randomized into five groups: (1) Sham: rats subjected to laminectomy only; (2) SCI: after laminectomy, a transection was made between T9 and T10 with a sharp blade, and 4 µL of iPSC culture medium were locally injected immediately after SCI; (3) H-Apln: 1 × 105 H-Apln iPSCs (Apln-overexpressing iPSCs) were locally injected immediately after SCI; (4) Green fluorescent protein (GFP): 1 × 105 GFP+ iPSCs (iPSCs infected with a GFP vector only) were locally injected immediately after SCI; and (5) ML221: ML221 (apelin inhibitor, 30 µg/rat) was intraperitoneally administered 30 min after SCI.
SCI surgery, cell transplantation, and inhibitor injection
The SCI transection model was established as previously reported.[22] Briefly, rats were anesthetized with 4% chloral hydrate (100 mg/kg body weight; Tianjin DaMao Chemical Reagent Factory, Tianjin, China). The spinal cords of sham group rats were exposed at T8–T10 by laminectomy of these vertebrae. For the SCI transection model, the spinal cord was transected at T9 using a No. 11 blade, and the bleeding was controlled using gauze. SCI group rats were immediately locally injected with 4 µL of iPSC culture medium using a microsyringe, while H-Apln group and GFP group rats were given the same volume of culture medium containing 5 × 105 iPSCs (Apln-overexpressing or GFP-infected only, respectively). After surgery, urination was aided twice a day until recovery of the micturition reflex.
Tissue processing
At designated time points post-injury, rats were anesthetized with 4% chloral hydrate and intracardially perfused with at least 200 mL of 0.9% physiological saline, followed by 400 mL of paraformaldehyde (PFA). Subsequently, 1-cm segments were obtained from the injured lesion.
Paraffin section histopathological staining
At designated time points after injury, the tissue around the injury site at T8–T10 (about 1 cm) was obtained and fixed in PFA for at least 48 h. Subsequently, the tissue was dehydrated in xylene followed by a gradient series of alcohol, embedded in paraffin, cut into 4-µm serial sections, heated at 60ºC for at least 2 h, and then stored at room temperature.
Hematoxylin and eosin (HE) staining
Paraffin sections were placed in xylene followed by a gradient series of alcohol, and then stained with hematoxylin for 5 min at room temperature. After rinsing sections in running water, they were differentiated in 1% hydrochloric acid and double-stained with eosin for 3 min. Finally, slides were dehydrated with a gradient of ethanol, permeabilized with xylene, and sealed.
Luxol Fast Blue (LFB) staining
Paraffin sections were placed in xylene, followed by 100% and 95% ethanol solutions. Next, sections were stained with LFB solution and heated at 60ºC overnight. The next day, sections were washed in 95% ethanol and then placed in 0.05% lithium carbonate aqueous solution for 10 s, followed by 75% alcohol for 30 s; the last two steps were repeated until the white and grey matter were clearly observable. Finally, slides were sealed after dehydration in ethanol and xylene.
Nissl staining
Paraffin sections were dewaxed and rehydrated before staining with cresyl violet. Subsequently, sections were differentiated in 75% ethanol solution and distilled water until Nissl bodies were clearly observable under a microscope. Numbers of Nissl bodies in the anterior horn were used to detect neuronal damage.
Frozen section preparation
Spinal cord tissues around the injured lesion were placed into PFA overnight at 4°C, dehydrated with sucrose solution (15% for 1 d and 30% for 2 d), embedded in optimum cutting temperature compound, and cut into 12-µm frozen sections with a microtome.
Immunofluorescence
Frozen sections were equilibrated to room temperature (RT), washed three times (15-min each) with phosphate-buffered saline (pH 7.2–7.4), blocked for 1 h with normal goat serum at RT, and incubated with primary antibody at 4ºC overnight. Following overnight incubation, sections were washed three times and incubated with secondary antibody for 2 h at RT. Finally, sections were washed another three times, nuclear stained with 4,6-diamidino-2-phenylindole (DAPI) for 8 min at RT, and sealed with an anti-fluorescence quencher. Images were obtained under a fluorescent microscope.
The following primary antibodies were used for immunofluorescence at the indicated dilutions: anti-apelin (1:400; Affinity Biosciences, Zhenjiang, China), anti-glial fibrillary acidic protein (GFAP;ab7260, 1:500; Abcam, Cambridge, UK), anti-GFAP (ab4674,1:1000, Abcam), anti-Iba1 (1:200, Abcam), anti-Olig2 (1:200; R&D Systems, Minneapolis, MN, USA), anti-NeuN (1:400; Proteintech, Rosemont, IL, USA), anti-nestin (1:300, Proteintech), anti-C3 (1:200, Proteintech), anti-CD68 (1:200, Abbkine, Wuhan, China), anti-BrdU (1:300, Abbkine), anti-NeuN (1:50; Cell Signaling Technology, Danvers, MA, USA).
The following fluorescent secondary antibodies were used at a suitable concentration: Alexa Fluor 488 goat-anti-rabbit (Invitrogen, Carlsbad, CA, USA), Alexa Fluor 594 goat-anti-mouse (Abbkine), Alexa Fluor 555 goat-anti-chicken (Bioss, Beijing, China), Alexa Fluor 594 rabbit-anti-goat (Abbkine), and Alexa Fluor 350 goat-anti-rabbit (Abbkine).
Western blotting
Total protein was extracted from spinal cord tissue using radioimmunoprecipitation assay buffer containing 1% phenylmethanesulfonylfluoride. Protein concentrations were measured using a BCA assay kit (Beyotime, Shanghai, China). Proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (using gels of different concentrations) and subsequently transferred onto polyvinylidene difluoride membranes. Next, membranes were incubated with the following primary antibodies at 4ºC overnight: anti-apelin (1:1000; Affinity Biosciences, Zhenjiang, China), anti-nestin (1:2000, Proteintech), anti-GFAP (1:4000, Abcam), anti-C3 (1:1000, Proteintech), and anti-Iba1 (1:1000, Abcam), as well as anti-GAPDH (1:10000, Proteintech) as an internal control. The following day, membranes were washed three times with Tris-buffered saline containing Tween (TBST, 15 min each), incubated with secondary antibodies at room temperature for 2 h, and then washed three times with TBST. Finally, protein bands were visualized using a Bio-Rad Image Lab system (Hercules, CA, USA), and densitometry analysis was performed with ImageJ software (http://imagej.nih.gov).
Quantitative Reverse Transcription PCR (qRT-PCR)
Total RNA was extracted from spinal cord tissue with TRIzol (Takara, Kusatsu, Japan) according to the manufacturer’s protocol. To assess the purity and concentration of total RNA templates, 260/280 and 260/230 absorbance ratios were determined using an ultraviolet-visible light spectrophotometer (NanoDrop 2000; Thermo Fisher Scientific, Waltham, MA, USA). A TranscriptorFirst Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) was used to synthesize cDNA from total RNA (1000 ng/sample). qRT-PCR was carried out using Premix Ex Taq™ (Probe qPCR) (Roche) with GAPDH as an internal reference gene. All primers (Table 1 for detailed primer information) were purchased from Accurate Biotechnology (Hunan, China). Data were analyzed by the 2−ΔΔCT method.
Table 1
Gene primers tested in comparative RT-PCR experiments
Gene
|
Forward primer (5’-3’)
|
Reverse primer (5’-3’)
|
Apln
|
CGATGGGAATGGGCTGGAAGA
|
CAGAAAGGCATGGGTCCCTTATG
|
Beta-Ⅲ-tubulin
|
CAGATGCTGGCCATTCAGAGTAAG
|
TGTTGCCGATGAAGGTGGAC
|
Olig2
|
ACCGAAGTAGTGAGAGCACTTGGAG
|
ATGGATGTACCCGCGTGTTG
|
Iba1
|
GAGGCCTTCAAGACGAAGTACA
|
GGGAACCCCAAGTTTCTCCAG
|
GFAP
|
GCCACCTCAAGAGGAACATCG
|
CTTGTGCTCCTGCTTCGACTC
|
IL-1 beta
|
CCCTGAACTCAACTGTGAAATAGCA
|
CCCAAGTCAAGGGCTTGGAA
|
IL-4
|
TGCACCGAGATGTTTGTACCAGA
|
TTGCGAAGCACCCTGGAAG
|
IL-10
|
CAGACCCACATGCTCCGAGA
|
CAAGGCTTGGCAACCCAAGTA
|
TNF-alpha
|
TCAGTTCCATGGCCCAGAC
|
GTTGTCTTTGAGATCCATGCCATT
|
GAPDH
|
GCACCGTCAAGGCTGAGAAC
|
TGGTGAAGACGCCAGTGGA
|
Enzyme-linked immunosorbent assay (ELISA)
Spinal cord tissues were homogenized in phosphate-buffered saline, followed by centrifugation at 5000×g for 10 min to extract protein samples. Protein concentrations in each sample were measured with a BCA assay kit (Beyotime) and adjusted to the same concentration. Apelin expression was measured in serum, while interleukin 1 beta (IL-1β), IL-10, and tumor necrosis factor alpha (TNF-α) were measured in tissue with ELISA kits (Could-Clone Crop, Wuhan, China) according to the manufacturer’s protocols. After detecting the absorbance at a 450-nm wavelength, the concentration of each factor was calculated based on a standard curve.
iPSC culture and transfection
Human iPSCs (Saibaikang Biotechnology, Shanghai, China) were cultured in mTeSR1 medium. iPSCs were transfected with lentivirus stably expressing Apln or GFP only (Jiman Gene, Shanghai, China). Stably transfected cells were selected by puromycin (MedChemExpress, Monmouth Junction, NJ, USA) before use.
NSC cultures from newborn rats
Primary spinal cord NSC cultures were prepared from newborn Sprague–Dawley rats (< 24 h) as previously described.[23] Briefly, newborn rats were anesthetized with isoflurane and decapitated. Spinal cord tissues were manually freed of meninges under a stereoscopic microscope, cut into small pieces (approximately 1-mm3), and then separated into cells by repeated pipetting using a 5-mL pipette until no macroscopic tissue was observed. Next, the suspension of NSCs was filtered through a 0.22-µm filter and centrifuged at 800×g for 6 min at RT. Finally, 5 × 105 cells in suspension were transferred into a T25 culture flask and cultured at 37°C with 5% CO2 (Thermo Fisher Scientific) for 7 d. NSC purity was confirmed by staining for nestin. After 48 h in differentiation conditions, GFAP immunocytochemistry was performed to evaluate the multi-directional differentiation ability of NSCs.[24] Cells in the third to fifth passage were used for experiments.
NSC differentiation
To evaluate the effect of apelin and its inhibitor ML221 on NSC differentiation, NSCs were cultured on poly-L-lysine (PL)-coated dishes with different dosages of apelin or its inhibitor ML221. Subsequently, immunocytochemistry using antibodies against GFAP (astrocyte marker), Iba1 (microglia marker), Olig2 (oligodendrocyte marker), and NeuN (neuron marker) was performed to assess NSC differentiation. In addition, mRNA levels of these markers was examined using specific primers and qRT-PCR, as described above.
Cell counting kit-8 (CCK8) assay
CCK8 assay was performed with a CCK8 kit (Beyotime) according to the manufacturer’s protocol. Briefly, 2 × 104 NSCs in 100 µL of induction medium were seeded in PL-coated 96-well plates, to which different dosages of apelin or ML221 were added. After culture for 24 h, 48 h, or 14 d, CCK8 detection was performed by adding 10 µL of CCK8 reagent to each well for 1 h before analysis. Cell proliferation rates were calculated as the absorbance of treated cells compared with an untreated control group.
Basso-Beattie-Bresnahan (BBB) scores
BBB scores[25] were used to evaluate rat hindlimb motor function at 1, 3, 7, and 14 dpi by two researchers who did not otherwise participate in experiments.
Statistical analyses
Quantification was performed by researchers blinded to the present study, and experiments were independently conducted three times with at least six replicates for each group. The resulting data are expressed as the mean ± standard deviation (SD), as calculated by Prism 8.0.1 (GraphPad Software, San Diego, CA, USA). Student’s t-test was used to compare two groups. For multiple comparisons, data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Assessment of BBB scores was analyzed by two-way RM ANOVA. P < 0.05 was considered statistically significant.