Patients & clinical samples
Transcriptome (count and FPKM value) information and mutational data of 539 ccRCC patients were downloaded from The Cancer Genome Atlas (TCGA, https://www.cancer.gov/tcga) database. Variance stabilizing transformation (VST) was used to normalize the data sets, and then, low-value genes were removed using heterogeneity analysis. According to the VHL gene, the wild-type VHL (VHLWT) and mutant VHL (VHLMT) patient groups were set, and then, by using the edgeR and clusterProfiler packages, gene set enrichment analysis (GSEA) was performed to determine significantly altered pathways between POLR2A Low and POLR2A high groups.
Cell lines and cell culture
The clear cell renal carcinoma cell lines 786-O and 769-P were purchased from American Type Culture Collection (ATCC, https://www.atcc.org) and maintained in RPMI medium modified (Cytiva, Shanghai, China) with 10% (v/v) fetal bovine serum (Biological Industries, Israel) at 37 °C in a humidified 5% CO2 incubator.
Transfection
786-O and 769-P cells were cultured in 6-well dishes. After 24 h, plasmids were transfected into 786-O and 769-P cells by the Roche X-tremeGENE DNA transfection reagent (Roche Co. Ltd., Shanghai, China). Real-time quantitative PCR and western blotting were used to verify POLR2A mRNA and protein expression, respectively.
Plasmids were purchased from Bio-company (Vigene Biosciences. Inc., Shandong, China),the sequence as follows: Sh1:CCGGGCGGAATGGAAGCACGTTAATCTCGAGATTAACGTGCTTCCATTCCGCTTTTTG;
Sh2:CCGGTGCGGAATGGAAGCACGTTAACTCGAGTTAACGTGCTTCCATTCCGCATTTTTG;
Sh3:CCGGCGACTTGAACTGCATCTTTAACTCGAGTTAAAGATGCAGTTCAAGTCGTTTTTG;
NCshRNA:TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT.
RNA isolation and real-time quantitative PCR
After 48 h of transfection, total RNA from 786-O and 769-P cells was isolated using the RNA fast 200 kit (Feijie Biotech, Shanghai, China) and then reverse-transcribed using the Prime Script™ RT reagent kit (Takara Biotechnology Co. Ltd., Dalian, China). Relative gene expression was detected by SYBR Green PCR Master Mix (Takara Biotechnology Co. Ltd., Dalian, China) and calculated by the 2–ΔΔCt method using GAPDH as a reference gene[26]. The sequences of the GAPDH and POLR2A primers were as follows:
GAPDH forward, 5′-ATGGGGAAGGTGAAGGTCGG-3′,
GAPDH reverse, 5′-GACGGTGCCATGGAATTTGC-3′,
POLR2A forward, 5’-GGGTGGCATCAAATACCCAGA-3’,
POLR2A reverse, 5’-AGACACAGCGCAAAACTTTCA-3’.
Western blot analysis
The cell lysis and western blotting protocols were described previously. Thirty micrograms of whole protein were separated by 12.5% SDS-PAGE (#PG113, Epizyme, Shanghai, China). An anti-POLR2A antibody (ABclonal, #A20363, 1:1000, Wuhai, China), anti-CDK4 antibody (Santa Cruz, #sc-23896, 1:400 Shanghai, China), anti-PCNA antibody (CST, #2586, 1:1000, Shanghai, China), anti-cyclin D1 antibody (Santa Cruz, #sc-8396, 1:200, Shanghai, China), and anti-β-actin antibody (Absin, #JB09, 1:1000, Shanghai, China) were used. The secondary antibodies were an anti‐rabbit IgG (Beijing Zhongshan, #ZB‐2301; 1:2,000; Beijing, China) and anti-mouse IgG (Beijing Zhongshan, #ZB-2305; 1:2000; Beijing, China).
MTT assay
A total of 4000 cells were plated in 96-well plates in triplicate for 48 h. Cell viability was quantified using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT). The growth rate was calculated as follows: average OD value in the POLR2A knockdown cell group/average OD value in the control group ×100%.
Clone formation assay
A total of 1000 cells were plated in 6-well plates in triplicate. After incubation for 7 days, cell colonies were visualized by crystal violet (0.5% m/v), and then, images were captured under a microscope.
Animal experiments
These experiment were approved by the institutional review board of the First Afliated Hospital of Xi’an Jiaotong University. We randomly separated 8 BALB/c nude mice (4 weeks, male) into 2 groups. These nude mice were subcutaneously injected with 3×106 cells (786-O control or shPOLR2A) into the left or right shoulder. tumor size and body weight were measured every 5 days for 25 days. Tumor volume was calculated using the following equation: tumor volume=length×width×height×0.523. At the end of the experiment, the animals were all euthanized, and tumor tissues were surgically excised from the nude mice.
Statistical analysis
Each experiment was repeated three times. Differences between two groups (Student’s t-test) were compared by GraphPad Prism software (Version 6.0 software, GraphPad, USA), and data are shown as the mean ± SD with error bars (SEM). P<0.05 was considered significant in our study.