Isolation and culture of chondrocytes
Specific pathogen free (SPF) Wistar rats (n = 5), weighting 180 ~ 200 g, were obtained from Hunan SJA Laboratory Animal Co., Ltd (Changsha, China). The rats were anesthetized with 50 mg/kg of pentobarbital sodium and then killed by cervical dislocation. The mice were immersed in 75% ethanol with their bilateral stifle joints collected under sterilized conditions. The articular cartilage was isolated and cut into pieces (1 mm × 1 mm × 1 mm), followed by washing with PBS. The pieces were then centrifuged at 800 r/min for 5 min prior to digestion by 0.25% pancreatin at 37℃ for 1 h. After the supernatant was removed, the cartilage was digested by 0.04% type II collagenase containing 5% FBS at 37℃ overnight using water bath. Then the cartilage was filtered using a 200 mesh screen before centrifuged at 800 r/min for 5 min. After the supernatant was discarded, the cells were washed and then were incubated with DMEM/F12 (Gibco, Grand Island, NY, USA) containing 10% FBS and 1% double-antibody at 37℃ under 5% CO2. All experiments were in accordance with the guidance for the care and use of laboratory animals.
Identification of chondrocytes
When the cells grew over 80% of the slides, the cells were washed with PBS for twice and fixed with 4% paraformaldehyde for 20 min at room temperature. Then toluidine blue staining and immunofluorescence staining of type II collagen were performed for identification of chondrocytes. Toluidine blue staining: The cells were subjected to staining by 1% toluidine blue for 30 min, dehydration by gradient alcohol and sealing by neutral balsam before observation under a microscope. Immunofluorescence staining: The cells were successively incubated with 3% H2O2 for 10 min and with goat serum at room temperature for 15 min. COL2A1 antibody (sc-52658, 1:100, Santa Cruz, CA, USA) was added for incubation at 4℃ overnight, and then FITC-labeled secondary antibody was incubated with the chondrocytes for 1 h. The excessive secondary antibody was removed by PBS wash, after which fluorescent quencher was added. The chondrocytes were visualized and photographed under a fluorescence microscope.
Treatment of chondrocytes
The powder of paeonol (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) was dissolved in DMSO to prepare for 1.0 g/L mother solution. The mother solution was maintained at room temperature and was diluted into the appropriate concentration before the performance of following experiments. Paeonol (0, 20, 50, 100, 200 and 1,000 mg/L) was used to treat the chondrocytes for 24 h before the toxicity of chondrocytes was measured by MTT. Then the PBS-dissolved IL-1β (10 ng/ml, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) reagent was applied to induce OA model in chondrocytes for 24 h.
Cell transfection
Sh-SIRT1 (2 µg) and sh-NC (2 µg) were synthesized by GenePharma (Shanghai, China), and transfection was conducted using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) for 24 h in accordance with the manufacturer’s protocols.
MTT
The chondrocytes were inoculated in 96-well plates (3,000 cells/well), and paeonol (0, 20, 50, 100, 200 and 1,000 mg/L) was added into each well. Each group has three repeated wells. The chondrocytes were cultured in an incubator at 37℃ under 5% CO2 for 24 h, followed by incubation with MTT (5 mg/ml) dissolved by 10 µl of DMSO for 4 h. Then the OD value was examined at 570 nm.
Flow cytometry
After corresponding treatment, the concentration of chondrocytes in all groups were adjusted to 105 cell/ml. Suspension (3 ml) of each sample was collected in centrifuge tubes (10 ml) and centrifuged at 500 r/min for 5 min, after which the culture solution was removed. Then the samples were washed with PBS and centrifuged at 500 r/min for 5 min. After that, the supernatant was discarded, and the cells were re-suspended using 100 µl of binding buffer. Annexin V-FITC (5 µl) and PI (5 µl) were mixed and incubated with the cells in dark for 15 min. The fluorescence of FITC and PI was detected by flow cytometer to analyze the apoptotic rate of chondrocytes. The detection on each group was performed in three times.
ELASA
The expressions of TNF-α, IL-17 and IL-6 were detected using ELISA kit (R&D Systems, MN, USA), and all procedures were measured according to the protocols.
qRT-PCR
TRIZOL was applied to extract the total RNAs (Invitrogen, Carlsbad, CA, USA), and RNAs were reversely transcribed using reverse transcription kit (TaKaRa, Tokyo, Japan) according to the instruction. The expressions of RNAs were examined using LightCycler 480 (Roche, Indianapolis, IN, USA) and the reaction conditions were performed in accordance with the directions of fluorescence quantitative PCR kit (SYBR Green Mix, Roche Diagnostics, Indianapolis, IN). The thermal cycle parameters were as follows: 95℃ for 5 s; 95℃ for 5 s, 60℃ for 10 s, 72℃ for 10 s (total of 45 cycles); and finally extension at 72℃ for 5 min. Each reaction was performed in triplication. GAPDH was used for normalization. Data were analyzed using 2−ΔΔCt and ΔΔCt was expressed as (Ct target gene - Ct internal control) experimental group - (Ct target gene - Ct internal control) control group. The primers of all genes and their internal controls were shown in Table 1.
Table 1
Primer sequences of all genes.
Name of primer
|
Sequences
|
SIRT1-F
|
GCAGGTAGTTCCTCGGTGTC
|
SIRT1 -R
|
CACAACTCAGCACGCAGAAC
|
MMP-1-F
|
GGGGGAAGTACCTTGACTGC
|
MMP-1-R
|
GTTGTCGGTCCACGTCTCAT
|
MMP-3-F
|
CTACCTCACCACGACCCCTA
|
MMP-3-R
|
CCCTTGTCTTGCCCAGAGAG
|
MMP-13-F
|
GGACTCACTGTTGGTCCCTG
|
MMP-13-R
|
GGATTCCCGCAAGAGTCACA
|
TIMP-1-F
|
GCCTCTCTTACAGGCCGTTT
|
TIMP-1-R
|
AGCAGGGCTCAGATTATGCC
|
GAPDH-F
|
CTCTCCTGTCCGGGAGTGTA
|
GAPDH-R
|
GTGATTAGGCCCACAGCCTT
|
Note: F, forward; R, reverse. |
Western blot
Total proteins were extracted using RIPA lysis buffer (Beyotime, Shanghai, China), and then were quantified by BCA kit (Beyotime, Shanghai, China). The proteins were heated with the loading buffer for denaturation through boiling water bath for 3 min. Electrophoresis was used for protein separation at 80 V for 30 min and then were switched to 120 V for 1 ~ 2 h. The proteins were subjected to membrane transferring through ice bath at 300 mA for 60 min. After that, the membranes were sealed with blocking buffer at room temperature for 60 min or at 4℃ overnight. The primary antibody for GAPDH (ab181602, 1:10000), SIRT1 (ab110304, 1:1000), MMP-1 (ab137332, 1:1000), MMP-3 (ab52915, 1:1000), MMP-13 (ab39012, 1:3000), TIMP-1 (ab61224, 1:1000), total-caspase-3 (ab13847, 1:500), cleaved-caspase-3 (ab49822, 1:500), Bax (ab32503, 1:1000), Bcl-2 (ab196495, 1:1000), IκBα (ab32518, 1:1000), p-IκBα (ab133462, 1:1000), p65 (ab16502, 1:2000),or p-p65 (ab86299, 1:2000) (all from Abcam, Cambridge, MA, USA) was incubated with the membranes at room temperature for 1 h, after which the secondary antibody was added and incubated at room temperature for 1 h. Finally, the membranes were detected after color development.
Statistical analysis
GraphPad prism7 was applied for statistical analysis, and all data were represented as average ± standard deviation (average ± SD). Difference between two groups was assessed through T test, and comparisons among multiple groups were measured using One-way analysis of variance with Dunnett's multiple comparisons test as post hoc test. P values of less than 0.5 were regarded as statistical significant.