Animal model
A total of 32 Sprague-Dawley (SD) rats (male, approximately 14 weeks) were obtained from Shanxi Bethune Hospital Shanxi Academy of Medical Sciences. Rats were kept on a 12‑h light/dark cycle at room temperature (approximately 22‑26˚C) with 50‑70% humidity. A rat model of AMI was established through the ligation of the left anterior descending coronary artery as previously described[26]. After the ligation for 30 min, reperfusion was performed through cutting the knot in the ligature. For the sham group, the procedure was same with no transient artery ligation. All animal experiments were performed according to the institutional animal ethics guidelines for the Care and Use of Research Animals of Shanxi Bethune Hospital Shanxi Academy of Medical Sciences and this study was approved by Shanxi Bethune Hospital Shanxi Academy of Medical Sciences. To explore the specific function of NORAD in vivo, approximately 10mg/kg body lentivirus carrying si-NORAD (silencing of NORAD) or negative control was intravenously injected into rats through the tail vein for 24 h before surgery. Mice were randomly divided into four groups (n = 8): Sham si-NC group, Sham si-NORAD group, AMI si-NC group and AMI si-NORAD group.
The determination of myocardial infarction
At 24 h after AMI or Sham operation, mice were euthanized via the intraperitoneal injection of Avertin (2,2,2-Tribromoethanol) (Sigma-Aldrich) (20 mg/kg). The whole heart was cut into 2 mm thick slices and stained with 1% triphenyltetrazolium chloride (TTC) at 37°C for 20 minutes after washing out remaining blood. The sizes of the TTC-stained area (red staining, ischemic but viable tissue) and unstained area [infarct myocardium (INF)] were analyzed with the Image Pro Plus 6.0 software (Media Cybernetics Inc.).
The evaluation of cardiac function
The cardiac function of rats was evaluated by the motion-mode echocardiography under the VEVO 770 high-resolution in vivo imaging system (FUJIFILM VisualSonics Inc.). Of which, the mean value of left ventricular fractional shortening (LVFS) was analyzed by M mode, and left ventricular internal dimension (LVIDs) were evaluated at end-systole (s) through four-chamber view.
HE staining assay
After animal experiments were finished, the heart tissues of rats were rapidly removed, fixed with 4% paraformaldehyde, embedded in paraffin wax and sliced into 4–5 µm thicknesses following dehydration. Then the sections were stained with hematoxylin and eosin (H&E) staining as previously described[27] and observed under a light microscope (Olympus, Tokyo, Japan).
Cell culture
The mouse cardiomyocyte cell line HL-1 (SCC065) were obtained from Sigma‑Aldrich (Merck KGaA). Cells were cultured with DMEM medium containing 10% FBS, and 1% penicillin‑streptomycin (Nacalai Tesque Inc.) at 37˚C with 5% CO2. To establish the cell model with hypoxia/re-oxygenation (H/R), HL-2 cells were firstly kept in a hypoxia incubator (approximately 1% O2, 5% CO2, 94% N2) at the density of 5 x 105 cells/ml for 20 h. Then cells were incubated under the normoxic conditions for 4 h, and collected for the subsequent experiments.
Cell transfection
Si-NORAD (silencing of NORAD), si-NC (control), miR-22-3p mimics (miR-22-3p overexpression) or miR-NC (control) was transfected into HL-1 cells by using Lipofectamine 2000 kit (Invitrogen, Carlsbad, CA). Si-NORAD forward: 5’-GCUGUCGGAAGAGAGAAAUTT-3’, reverse: 5’-AUUUCUCUCUUCCGACAGCTT-3’; si-NC forward: 5′-UUCUCCGAACGUGUCACGUTT-3′, reverse: 5′- ACGUGACACGUUCGGAGAATT−3′; miR-22-3p mimics : 5’- GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCTTTATGTCCTGACCCAGCTAAAGCTGCCAGTTGAAGAACTGTTGCCCTCTGCC-3’; miR-NC: 5'-UUC UCCGAACGUGUCACGUTT-3'. For NORAD overexpression, the cDNA fragments of NORAD was amplified and cloned into expression vector pcDNA3.1 (Richmond, BC, Canada). Of which, si-NORAD/si-NC was used at a concentration of 500 ng/well, and miR-22-3p mimic/miR-NC was approximately 100 nM (Shanghai GenePharma Co., Ltd.). After transfection for 48 h, cells were collected for the subsequent experiments.
Luciferase reporter assay
The cDNA fragments of NORAD/PTEN containing either the predicted potential miR-22-3p binding site (wild type, WT) or mutant type (MUT) sequences were amplified by PCR and cloned into Renilla luciferase reporter vector pmirGLO (Promega, Madison, WI, USA). Then HL-1 cells were transfected with luciferase reporter plasmids and miR-22-3p mimics or miR-NC. After transfection for 48 h, cells were lysed and the relative luciferase activity was evaluated by using dual luciferase reporter system.
qRT-PCR
Total RNA of heart tissues or cells was extracted by the TRIzol reagent. The quantitative polymerase chain reaction was performed by using 7500 Fast Real-time PCR system (Applied Biosystems) based on the SYBR Green PCR Kit (Toyobo). The relative fold changes were calculated by 2-ΔΔCt method[28], with β‑actin and U6 as the internal reference. The primers used in this study as follows: miR‑22-3p forward: 5’-GCTGAGCCGCAGTAGTTCTT-3’, reverse: 5’-GGCAGAGGGCAACAGTTCTT-3’; PTEN forward: 5’-TAGAGCGTGCGGATAATGAC-3’, reverse: 5’-GATGGCTCCTCTACTGTTTT-3’; β‑actin forward: 5’-CCTCTATGCCAACACAGTGC-3’, reverse: 5’-CATCGTACTCCTGCTTGCTG-3’; U6 forward: 5’-CTCGCTTCGGCAGCACA-3’, reverse: 5’-AACGCTTCACGA ATTTGCG-3’.
Western blot
Total protein of cultured cells was isolated by using RIP lysis buffer according to the manufacturer’s instructions. Approximately equal amounts of protein were separated by 10% SDS-PAGE and then transferred into PVDF membranes (Immobilon-P; EMD Millipore). After blocking with 5% skimmed milk, the membranes were incubated with primary antibodies including PTEN (1:1000, abcam), AKT (1:2000, CST), p-AKT (1:1000, CST), mTOR (1:2000, abcam), p-mTOR (1:1000, abcam), and internal reference β‑actin (1:2000, abcam) overnight at 4˚C. After washing for three times, the membranes were incubated with HRP-conjugated secondary antibody for 2–3 h at room temperature. Finally, the images of bands were observed by a ImageJ2X software using the ECL reagent (Thermo).
RNA pull down assay
HL-1 cells were transfected with biotin-labeled negative control, biotin-labeled miR-22-3p WT or biotin-labeled miR-22-3p MUT. The probes used as follows, miR-22-3p WT: 5’-UGUCAAGAAGUUGACCGUCGAA-3’; miR-22-3p MUT: 5’-UGUCAAGGAGUUCAAACAGCGA-3’. After transfection for 48 h, the whole-cell extraction was incubated with M-280 streptavidin magnetic beads (Invitrogen, Carlsbad, CA, USA) at 4°C for 3-5 h. The co-precipitated RNA was purified by using TRIzol reagent supplementing with proteinase K, and analyzed by qRT-PCR.
The detection of L‑lactate dehydrogenase (LDH) and malondialdehyde (MDA)
The LDH level and MDA level in the cell supernatant was detected by LDH assay kit (ab102526, Abcam) or Cellular Malondialdehyde Test kit (A003-2, Nanjing Jiancheng Bioengineering Institute) according to their corresponding manufacturer's instructions.
Flow cytometry
Cells were harvested after 48 h for transfection, and re-suspended in the precooled phosphate buffered saline. 5 μl Annexin V-FITC solution (Sangon Biotech) was added to each well and incubated for 15 min at room temperature in the dark. After centrifugation and washed with binding buffer, cells were re-suspended again in solution containing 190 μl binding buffer and 10 μl propidium iodide (PI, Sangon Biotech). Then apoptosis rate was analyzed by using flow cytometry (Beckman Coulter, Fullerton, CA, USA).
Statistical analysis
Data were presented as the mean ± SD which were derived from at least three independent experiments. Difference between two groups was determined by Student's t-test and that among multiple groups was analyzed by one-way ANOVA. P < 0.05 was considered as the significant threshold .