Correlation of tumor necrosis factor-α -308G&gt;A polymorphism with susceptibility, clinical manifestations and severity in Behçet syndrome: evidences from an Italian genetic case-control study

doi:10.21203/rs.2.19801/v1

PDF

Research article

Correlation of tumor necrosis factor-α -308G>A polymorphism with susceptibility, clinical manifestations and severity in Behçet syndrome: evidences from an Italian genetic case-control study

https://doi.org/10.21203/rs.2.19801/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 31 Dec, 2019

You are reading this latest preprint version

Background The tumor necrosis factor (TNF)α is a multifunctional proinflammatory cytokine, implicated in a variety of diseases, including Behçet syndrome (BS), a rare vasculitis with a wide spectrum of clinical manifestations. The aim of the present study was to investigate the association between a functional drug-response TNFα gene polymorphism (at the positions of -308; rs1800629) and both disease susceptibility and clinical manifestations in a cohort of Italian BS patients compared with healthy controls (HC).

Methods We recruited 130 Italian patients with BS consecutively seen at Rheumatology Institute of Lucania (Italy) and 100 ethnically, age and gender matched HC. Demographic and clinical features were retrieved by medical records. Specific primer pairs were designed for TNFα coverage. Genomic DNA isolation, primer-specific PCR amplification and direct sequencing were performed for genotyping our group of patients and controls. In silico analysis was downstream performed using Mutation Surveyor software (SoftGenetics, USA) and NCBI-BlastN on line tool for the query-subject similarity analysis.

Results The genotype distribution of BS patients and HC underlined a higher percentage of wild-type GG genotype in BS patients group vs HC (106/130 patients, 81.5% vs 91/100 HC, 91%; p<0.05), while the heterozygous genotype (GA) was identified in 24/130 patients (18.5%) vs 9/100 HC (9%) (p<0.05). GA genotype was significantly associated with the disease (OR=2.29, 95% CI 1.01-5.18). No significant association was recognized between the SNP and the BS clinical manifestations, as well as with disease severity (Krause's index).

Conclusions We found statistically significant higher frequency of TNFα rs1800629 GA genotype in patients than in controls. No significant association was recognized between the polymorphism and the clinical parameters, as well as between the SNP and the disease severity. Our data need to be confirmed in larger cohort of patients and matched controls.

Rheumatology

Medical Genetics

Behçet syndrome

genetics

polymorphism

tumor necrosis factor

Behçet syndrome (BS) is a chronic vasculitis characterized by a wide spectrum of clinical manifestations, that shares some clinical features with well-recognized autoinflammatory diseases (AIDs) [1–4]. Some evidences of the key role of inflammasome-related genes in AIDs and BS were underlined by genetic studies [5–7]. In this context, the tumor necrosis factor (TNF)α was reported as marker of disease due to its involvement in the pathogenesis of BS. TNFα is located on chromosome 6p21.3 and encodes a 233-amino-acid type II transmembrane protein. TNFα is a multifunctional proinflammatory cytokine belonging to the TNF superfamily, implicated in a variety of diseases, ranging from autoimmune diseases, cardiovascular disorders, diabetes mellitus and cancer. Anti-TNFα therapies are used for the treatment of various inflammatory and autoimmune rheumatic diseases with positive but variable outcomes for the patients. The causes of inadequate response or treatment failure remain unknown and can be related to several factors, such as an alternative non-TNFα related pathway of inflammation and/or anti-drug antibodies presence or development [8–12]. In addition, the alterations of TNFα expression can be associated with polymorphic alleles of TNFα gene having a pathogenetic role. TNFα –308A gene variation (rs1800629) is a single nucleotide polymorphism (SNP) located within the gene promoter consisting in the guanine (G) to adenine (A) substitution (NG_007462.1:g.4682G>A; HGVS nomenclature). The polymorphism was previously associated with increased susceptibility to and severity of rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease, vitiligo, multiple sclerosis, cardiomyopathy and malignancies, as well as of pre-eclampsia and celiac disease. It was reported that patients with the AA genotype and inflammatory diseases who are treated with anti-TNFα therapies may be less likely to have improvement in symptoms as compared to patients with the GG genotype [8–21]. TNFα –308A has been associated with high production of TNFα and poor response to anti-TNF therapy also in BS. The SNP frequency was analysed in various populations reporting inconsistent and/or conflicting data about the association of the polymorphism and both the susceptibility and the clinical patterns of BS [14, 22–32].

To date, these aspects were not analyzed in Italian BS population. The aim of this study was to investigate the frequency of rs1800629 and the possible association between the SNP and both disease susceptibility and clinical features and disease severity in a cohort of Italian BS patients compared with healthy controls (HC).

Study population. Consecutive patients with BS were recruited at Rheumatology Institute of Lucania (IReL) - Italy. Ethnically, age and gender matched healthy controls (HC) were also recruited among hospital and university employees without clinical signs and family history of both rheumatic diseases and AIDs. Diagnosis of BS was made according to International Study Group (ISG) for BS criteria [33]. Patients demographic and clinical data were collected by medical records. Disease severity was assessed according Krause’s index [34]. Informed consent was collected for all participants involved in the study. The study was approved by the Regional Ethics Committee (Permit Number: 705/2017).

Molecular analysis. We designed a specific primer pair for the coverage of TNFα rs1800629 using NCBI Primer-Blast tool: 5’TTCCCTCCAACCCCGTTTTC3’ and 5’CTGCACCTTCTGTCTCGGTT3’. Genomic DNA was isolated from all subjects whole blood using EuroGOLD Blood DNA Mini kit (Euroclone®, Italy) and quantified using NanoDrop™ 1000 spectrophotometer (NanoDrop Technologies, Inc). PCR amplification was performed using Q5 Hot Start High-Fidelity DNA Polymerase (BioLabs Inc, New England) at the following conditions: 1) initial denaturation: 98°C/5 min; 2) thermocycling: 98°C/1 min; 62°C/1 min; 72°C/2 min (30 cycles); 3) final extension: 72°C/5 min. PCR products were analyzed by gel electrophoresis (1.5% agarose gel). A negative control was used for all PCR reactions. Good-quality PCR amplicons were sequenced (Sanger method) using Microsynth AG sequencing service (Germany). In silico analysiswas downstream performed using Mutation Surveyor software (SoftGenetics, USA) and NCBI-Blast Nucleotide on line tool for comparing query nucleotide sequences to sequence databases (subject sequences).

Statistical analysis. We used Chi-square or Fisher’s exact tests for comparing: a) genotype frequencies between patients and HC; b) genotype frequencies and BS clinical manifestations; c) genotype frequencies and disease severity score (Krause’ score). The odds ratio (OR) was calculated for testing the strength of association between BS and each genotype. The 95% confidence interval (CI) was used to estimate the precision of the OR. p-values less than 0.05 were considered statistically significant.

A total of 230 Italian subjects were included in the study. Of which, 130 were consecutive patients with BS and 100 were matched HC. Table 1 reported the demographic and the clinical features of BS patients. The mean age of the patients at disease onset was equal to 45.8±12.3 years. Male/Female ratio was 64:66, while for HC sex ratio was 48M:52F and mean age was 44.1±12.0 years, without statistically significant differences between patients and HC (p>0.05). BS patients predominant lesions were oral ulcers (100%), eye lesions (86.2%), skin lesions (72.3%), genital ulcers (57.7%), followed by joint involvement (50.0%). HLA-B51 positivity was found in 81/130 patients (62.3%).

Genotyping of TNFα rs1800629 showed a higher percentage of wild-type GG genotype in BS patients group (106/130 patients, 81.5%) than in HC (91/100 subjects, 91%) (p<0.05). The heterozygous genotype (GA) was identified in 24/130 patients (18.5% of cases) and in 9/100 HC (9%) (p<0.05). This genotype was significantly associated with the disease (OR=2.29, 95% CI 1.01-5.18). No AA genotype was found in patients group and in controls group (Table 2).

Table 1. Demographic features and clinical manifestations of our group of BS patients.

Demographics	BS patients, n=130
Age, years	45.8±12.3 years
Male/Female	64M:66F
Clinical manifestations
Oral ulcers, n (%)	130 (100.0%)
Genital ulcers, n (%)	75 (57.7%)
Skin disease, n (%)	112 (72.3%)
Ocular involvement, n (%)	82 (86.2%)
Neurologic involvement, n (%)	26 (20.0%)
Vascular involvement, n (%)	25 (19.2%)
Joint involvement, n (%)	65 (50.0%)
Gastrointestinal involvement, n (%)	6 (4.6%)
HLA-B51 positivity	81 (62.3%)

Abbreviations: BS, Behçet syndrome; n, number of subjects

Table 2. Genotype frequencies of rs1800629 in BS patient and control groups.

SNP

Genotype

BS patients (n=130)

n (%)

Controls (n=100)

n (%)

p-value

OR (95% CI)

rs1800629

106 (81.5%)

24 (18.5%)

0 (0.0%)

91 (91.0%)

9 (9.0%)

0 (0.0%)

0.0424*

---

0.44 (0.19-0.99)

2.29 (1.01-5.18)

---

Abbreviations: BS, Behçet syndrome; n, number of subjects; OR, odds ratio; CI, confidence interval

We compared the frequency of rs1800629 genotypes with the distribution recognized in other populations (Table 3). The data now available demonstrated that the genotype and allele frequencies of rs1800629 vary substantially among different ethnic groups of BS patients.

Table 3. rs1800629 frequency in patients with BS and controls in different ethnic groups.

rs1800629

BS Patients

Controls

Author

Ethnicity

Patients (n)

Controls (n)

n (%)

Abdolmohammadi and Bonyadi, 2017 [22]

Iranian Azer Turks

(6.2%)

(93.8%)

(0.0%)

(6.2%)

(93.8%)

(0.0%)

Al-Okaily et al, 2015 [14]

Saudi

211

(3.3%)

(96.7%)

(0.0%)

116

(55.0%)

(37.9%)

(7.1%)

Ates A et al, 2006 [23]

Tukish

107

102

(80.4%)

(19.6%)

(0.0%)

(82.4%)

(15.7%)

(1.9%)

Ates O et al, 2010 [24]

Tukish

102

(74.5%)

(25.5%)

(0.0%)

(83.3%)

(16.7%)

(0.0%)

Bonyadi et al, 2009 [25]

Iranian Azer Turks

(90.6%)

(9.4%)

(0.0%)

(79.8%)

(17.7%)

(2.5%)

Duymaz-Tozkir et al, 2003 [26]

Tukish

(79.8%)

(18.2%)

(2.0%)

(69.8%)

(27.1%)

(3.1%)

Kamoun et al, 2007 [27]

Tunisian

157

(75.3%)

(20.2%)

(3.4%)

122

(77.7%)

(18.5%)

(3.8%)

Lee et al, 2003 [28]

Korean

(88.3%)

(10.6%)

(1.1%)

(91.5%)

(8.5%)

(0.0%)

Park et al, 2006 [29]

Korean

254

344

227

(89.4%)

(10.6%)

(0.0%)

283

(82.3%)

(16.8%)

(0.9%)

Radouane et al, 2012 [30]

Moroccon

120

112

(68.3%)

(31.7%)

(0.0%)

(60.7%)

(33.0%)

(6.3%)

Stork et al, 2008 [31]

German

(84.8%)

(15.2%)

(0.0%)

(86.3%)

(13.7%)

(0.0%)

Stork et al, 2008 [31]

Turkish

(96.7%)

(3.3%)

(0.0%)

(90.0%)

(10.0%)

(0.0%)

A subset analysis was carried out for investigating the difference in genotype frequencies in the clinical subsets of BS. No statistically significant differences were found when both GG and GA frequencies were analyzed comparing the presence and the absence of each clinical manifestation (p>0.05) (Table 4). We also compared the SNP genotype frequencies according to Krause' severity index: no statistically significant differences were found when the score was calculated for the patient group with GG genotype (Krause's score=5.095±2.528) and for the patient group with GA genotype (Krause's score=5.081±2.430) (p>0.05).

Table 4. The association between genotype frequencies and BS clinical manifestations. All p-values were >0.05.

Clinical manifestations

Genotypes

Genital ulcers

With (n=75)

Without (n=55)

65 (86.7%)

41 (74.5%)

10 (13.3%)

14 (25.5%)

Skin disease

With (n=112)

Without (n=18)

92 (82.1%)

14 (77.8%)

20 (17.9%)

4 (22.2%)

Ocular involvement

With (n=82)

Without (n=48)

66 (80.5%)

40 (83.3%)

16 (19.5%)

8 (16.7%)

Neurologic involvement

With (n=26)

Without (n=104)

20 (76.9%)

86 (82.7%)

6 (23.1%)

18 (17.3%)

Vascular involvement

With (n=25)

Without (n=105)

21 (84.0%)

85 (81.0%)

4 (16.0%)

20 (19.0%)

Joint involvement

With (n=65)

Without (n=65)

54 (83.1%)

52 (80.0%)

11 (16.9%)

13 (20.0%)

Gastrointestinal involvement

With (n=6)

Without (n=124)

4 (66.7%)

102 (82.3%)

2 (33.3%)

22 (17.7%)

This is the first report of assessment of TNF-α –308G/A allele promoter SNP distribution and its association with BS clinical manifestations in patients from South Italy compared with sex-age and ethnically-matched HC. Our sample size is higher than other populations analyzed in European studies.

We found a statistically significant higher frequency of GA genotype in patients group than in HC. No association between rs1800629 genotypes and any clinical hallmark was recognized, as well as no relationship was found considering the disease severity according Krause’s index.

We focused our attention on TNF-α due to the role of its polymorphisms as genetic contributors to BS immunopathology. Genetic factors that predispose to BS are considered to have a significant role in the disease development, so various loci were described as susceptibility markers, beside the HLA-B51, known as the major BS risk allele [1, 5–7, 35–41]. TNF-α is encoded in the HLA complex on chromosome 6, a region that has been known to be associated with BS. In particular, TNF-α rs1800629 is localized on the gene transcriptional start site and is related to the specific regulation of TNF-α synthesis. In fact, the TNF-α regulatory regions may play a role in cytokine production, and the binding of inducible cytoplasmatic factors may result in the translational blockade, leading to the dysregulated cytokine production. Genotype-phenotype correlation studies reported that G allele conferred two-fold lower effects on the transcription level than A allele [8–21, 26].

In our cohort, the association between GA genotype and disease risk could be explained taking into account that the presence of A allele could enhance the inﬂammatory reactivity influencing the binding of the transcriptional factors and contribute to the inflammation signature of BS.

Similarly to our investigation, several studies assessed the influence of the promoter polymorphism on the expression of TNF-α in BS or its susceptibility or its severity and clinical features, as well as its role as drug-response allele [14, 22–32]. The effect of geographical differences, rather than the high genetic variation, are important factors for the adaptability and the evolution of any population.

The low frequency of AA genotype is a common finding in several studies. The frequency of rs1800629 found in our cohort was very similar to the distribution reported in Turkish population by Duymaz-Tozkir and colleagues [26] (79.8% for GG genotype, 18.2% for GA genotype) and Ates and collaborators (80.4% for GG genotype, 19.6% for GA genotype) [23]. AA genotype was absent in both groups. The SNP frequency was previously studied by another research group in the same Turkish population with comparable results (74.5% for GG genotype, 25.5% for GA genotype and 0.0% for AA genotype) [24]. The frequencies of our group of controls were very similar to the distribution found in the Korean [28] and Turkish [31] populations.

About the correlation between the SNP and the clinical manifestations of BS, few studies are now available. In agreement with our data, Ates and collaborators reported no association of the polymorphism and both BS clinical hallmark and severity [23]. The polymorphism did not show any association with clinical ﬁndings also in Tukish population [22, 25]. Lee and colleagues studied the SNP genotypes according to the presence of uveitis, recognising that the presence of rs1800629 in patients with uveitis were not different from those without uveitis [28]. The comparison between patients with severe and mild uveitis was also investigated in Duymaz-Tozkir et al’s paper; the authors reported the haplotypic distribution (–308G/–376A) in the disease severity groups did not show significant differences, while the comparison between patients with severe and mild uveitis showed higher frequency of the same haplotype in severe cases than mild cases [26].

Here we studied the distribution of TNFα rs1800629 in a group of Italian BS patients compared with HC and the relation of the SNP with disease clinical hallmarks and severity. We found statistically significant higher frequency of GA genotype in patients group than in controls. No significant association was recognized between the polymorphism and the clinical parameters, as well as between the SNP and the disease severity. About the clinical significance of our findings, we underline that the SNP is a promoter variation that could affect the auto-inflammatory response and have genetically and functionally implication in BS etiopathogenesis. Analyses of a larger cohort of patients and matched controls are need to confirm our preliminary data and to clarify the SNP role.

AIDs, autoinflammatory diseases

BS, Behçet syndrome

CI, confidence interval

HLA, Human Leukocyte Antigen

ISG, International Study Group

MHC, Major Histocompatibility Complex

GWAS, Genome-wide association study

OR, odds ratio

ISG, International Study Group

PCR, Polymerase Chain Reaction

SNP, single nucleotide polymorphism

TNFα, tumor necrosis factor alpha

Ethics approval and consent to participate. All subjects included in the study provided their written, informed consent to participate. The Regional Ethics Committee approved the study (Permit Number: 705/2017).

Consent for publication. Not applicable.

Data availability. The data that support the findings of this study are available from the corresponding author PL on reasonable request.

Competing interest. The authors declare no financial and non-financial competiting interests.

Funding. No funding was received.

Authors’ contributions. MCP, PL and GM conceived and designed the study. MCP, GS, RPR, ARL and TC performed the experiments. MCP, SD, PL, GM and AAP participated in the analysis and interpretation of the data. PL, NL, MCP, GS, RPR, ARL and GM contributed in the acquisition of data. MCP wrote the first paper draft. All authors were involved in drafting, reading and revising the paper and approved the final version.

Acknowledgements. Many thanks to dear Professor Ignazio Olivieri for being our example and our guide.

[1] Burillo-Sanz S, Montes-Cano MA, García-Lozano JR, Ortiz-Fernández L, Ortego-Centeno N, García-Hernández FJ. Mutational profile of rare variants in inflammasome-related genes in Behçet disease: A Next Generation Sequencing approach. Sci Rep. 2017;7:453.

[2] Lin L, Hongsong Y, Yanni J, Deng B, Bai L, Kijlstra A et al. Genetic Variations of NLR family genes in Behcet’s Disease. Sci Rep. 2016;6:20098.

[3] Konè-Paut I, Sanchez E, Le Quellec A, Manna R, Touitou I. Autoinflammatory gene mutations in Behçet’s disease. Ann Rheum Dis. 2007;66:832-834.

[4] Yüksel S, Eren E, Hatemi G. Sahillioğlu AC, Gültekin Y, Demiröz D. Novel NLRP3/cryopyrin mutations and pro-inflammatory cytokine profiles in Behçet’s syndrome patients. Int Immunol. 2013;26:71-81.

[5] Gul A. Pathogenesis of Behçet's disease: autoinflammatory features and beyond. Semin Immunopathol. 2015;37(4):413-8.

[6] Takeuchi M, Kastner DL, Remmers EF. The immunogenetics of Behçet’s disease: A comprehensive review. J Autoimmun. 2015;64:137-148.

[7] Deng Y, Zhu W, Zhou X. Immune Regulatory Genes Are Major Genetic Factors to Behcet Disease: Systematic Review. Open Rheumatol J. 2018;12:70-85.

[8] Marotte H, Arnaud B, Diasparra J, Zrioual S, Miossec P. Association between the level of circulating bioactive tumor necrosis factor alpha and the tumor necrosis factor alpha gene polymorphism at -308 in patients with rheumatoid arthritis treated with a tumor necrosis factor alpha inhibitor. Arthritis Rheum. 2008;58(5):1258-63.

[9] O'Rielly DD, Roslin NM, Beyene J, Pope A, Rahman P. TNF-alpha-308 G/A polymorphism and responsiveness to TNF-alpha blockade therapy in moderate to severe rheumatoid arthritis: a systematic review and meta-analysis. Pharmacogenomics J. 2009;9(3):161-7.

[10] Pavy S, Toonen EJ, Miceli-Richard C, Barrera P, van Riel PL, Criswell LA et al. Tumour necrosis factor alpha -308G->A polymorphism is not associated with response to TNFalpha blockers in Caucasian patients with rheumatoid arthritis: systematic review and meta-analysis. Ann Rheum Dis. 2010;69(6):1022-8.

[11] Zeng Z, Duan Z, Zhang T, Wang S, Li G, Gao J et al. Association between tumor necrosis factor-α (TNF-α) promoter -308 G/A and response to TNF-α blockers in rheumatoid arthritis: a meta-analysis. Mod Rheumatol. 2013;23(3):489-95.

[12] Bek S, Bojesen AB, Nielsen JV, Sode J, Bank S, Vogel U et al. Systematic review and meta-analysis:pharmacogenetics of anti-TNF treatment response in rheumatoid arthritis. Pharmacogenomics J. 2017;17(5):403-411.

[13] Aflatoonian M, Moghimi M, Akbarian-Bafghi MJ, Morovati-Sharifabad M, Jarahzadeh MH, Neamatzadeh H. Association of TNF- α-308G>A polymorphism with susceptibility to celiac disease: a systematic review and meta-analysis. Arq Gastroenterol. 2019;56(1):88-94.

[14] Al-Okaily F, Arfin M, Al-Rashidi S, Al-Balawi M, Al-Asmari A. Inflammation-related cytokine gene polymorphisms in Behçet's disease. J Inflamm Res. 2015;8:173-80.

[15] Badano I, Stietz SM, Schurr TG, Picconi AM, Fekete D, Quintero IM et al. Analysis of TNFalpha promoter SNPs and the risk of cervical cancer in urban populations of Posadas (Misiones, Argentina). J Clin Virol. 2012;53:54-59.

[16] Liang Y, Xu WD, Zhang M, Qiu LJ, Ni J, Wang XS et al. Meta-analysis of association between cytokine gene polymorphisms and Behcet's disease risk. Int J Rheum Dis. 2013;16(6):616-24.

[17] Wang L, Ma K, Wang Z, Mou Y, Ma L, Guo Y. Association between tumor necrosis factor alpha rs1800629 polymorphism and risk of cervical cancer. Int J Clin Exp Med. 2015;8(2):2108-17.

[18] Wang L, Qu G, Wu W, Tang X, Sun Y. Association between tumor necrosis factor-α-308G/A gene polymorphism and susceptibility to pre-eclampsia: An updated meta-analysis. Cytokine. 2018;111:278-286.

[19] Yang F, Wei K, Qin Z, Shao C, Shu Y, Shen H. Association between TNF-ɑ-308G/A polymorphism and esophageal cancer risk: An updated meta-analysis and trial sequential analysis. J Cancer. 2019;10(5):1086-1096.

[20] Zhang M, Xu WD, Wen PF, Liang Y, Liu J, Pan HF, et al. 2013. Polymorphisms in the tumor necrosis factor gene and susceptibility to Behcet's disease: an updated meta-analysis. Mol Vis. 2013;19:1913-24.

[21] Zhang Y, Cao Y, Xin L, Gao N, Liu B. Association between rs1800629 polymorphism in tumor necrosis factor-α gene and dilated cardiomyopathy susceptibility: Evidence from case-control studies. Medicine (Baltimore). 2018;97(50):e13386.

[22] Abdolmohammadi R, Bonyadi M. Polymorphisms of Promoter Region of TNF-α Gene in Iranian Azeri Turkish Patients with Behçet's Disease. J Korean Med Sci. 2017;32(1):33-37.

[23] Ateş A, Kinikli G, Düzgün N, Duman M. Lack of association of tumor necrosis factor-alpha gene polymorphisms with disease susceptibility and severity in Behçet's disease. Rheumatol Int. 2006;26(4):348-53.

[24] Ateş O, Dalyan L, Hatemi G, Hamuryudan V, Topal-Sarıkaya A. Analyses of functional IL10 and TNF-α genotypes in Behçet's syndrome. Mol Biol Rep. 2010;37(7):3637-41.

[25] Bonyadi M, Jahanafrooz Z, Esmaeili M, Kolahi S, Khabazi A, Ebrahimi AA et al. TNF-alpha gene polymorphisms in Iranian Azeri Turkish patients with Behcet's Disease. Rheumatol Int. 2009;30(2):285-9.

[26] Duymaz-Tozkir J, Gül A, Uyar FA, Ozbek U, Saruhan-Direskeneli G. Tumour necrosis factor-alpha gene promoter region -308 and -376 G-->A polymorphisms in Behçet's disease. Clin Exp Rheumatol. 2003;21(4):S15-8.

[27] Kamoun M, Chelbi H, Houman MH, Lacheb J, Hamzaoui K. Tumor necrosis factor gene polymorphisms in Tunisian patients with Behcet's disease. Hum Immunol. 2007;68(3):201-5.

[28] Lee EB, Kim JY, Lee YJ, Park MH, Song YW. TNF and TNF receptor polymorphisms in Korean Behcet's disease patients. Hum Immunol. 2003;64(6):614-20.

[29] Park K, Kim N, Nam J, Bang D, Lee ES. Association of TNFA promoter region haplotype in Behçet's Disease. J Korean Med Sci. 2006;21(4):596-601.

[30] Radouane A, Oudghiri M, Chakib A, Bennani S, Touitou I, Barat-Houari M. SNPs in the TNF-α gene promoter associated with Behcet's disease in Moroccan patients. Rheumatology (Oxford). 2012;51(9):1595-9.

[31] Storz K, Löffler J, Koch S, Vonthein R, Zouboulis CC, Fresko I et al. IL-6 receptor, IL-8 receptor and TNF-alpha238 (G/A) polymorphisms are not associated with Behçet's disease in patients of German or Turkish origin. Clin Exp Rheumatol. 2008;26:S103-6.

[32] Touma Z, Farra C, Hamdan A, Shamseddeen W, Uthman I, Hourani H et al. TNF polymorphisms in patients with Behçet disease: a meta-analysis. Arch Med Res. 2010;41(2):142-6.

[33] Weichsler B, Davatchi F, Mizushima Y, Hamza M, Dilsen N et al. Criteria for diagnosis of Behcet's disease. International Study Group for Behcet's Disease. Lancet. 1990. 335(8697):1078-1080.

[34] Krause I, Rose Y, Kaplan I, Milo G, Guedj D, Molad Y et al. Recurrent aphthous stomatitis in Behçet’s disease: clinical features and correlation with systemic disease expression and severity. J Oral Pathol Med. 1999;28:193-196.

[35] Gul A. Genetics of Behçet’s disease: lessons learned from genomewide association studies. Current Opinion in Rheumatology. 2014;26: 56-63.

[36] Khaib Dit Naib O, Aribi M, Idder A, Chiali A, Sairi H, Touitou I et al. Association Analysis of IL10, TNF-α, and IL23R-IL12RB2 SNPs with Behçet's Disease Risk in Western Algeria. Front Immunol. 2013;4:342.

[37] Kirino Y, Bertsias G, Ishigatsubo Y, Mizuki N, Tugal-Tutkun I, Seyahi E et al. Genome-wide association analysis identifies new susceptibility loci for Behçet’s disease and epistasis between HLA-B*51 and ERAP1. Nat Genet. 2013;45(2):202-207.

[38] Leccese P, Padula MC, Santospirito EV, Colucci R, Lascaro N, D'Angelo S. HLA-B*51 subtypes molecular analysis in a series of Italian patients with Behçet's syndrome. Joint Bone Spine. 2019;86(6):807-808.

[39] Ombrello MJ, Kastner DL, Remmers EF. Endoplasmic reticulum-associated amino-peptidase 1 and rheumatic disease: genetics. Curr Opin Rheumatol. 2015;27:349-356.

[40] Padula MC, Leccese P, Lascaro N, Carbone T, Gilio M, Padula AA et al. Genotyping of Italian patients with Behçet syndrome identified two novel ERAP1 polymorphisms using sequencing-based approach. Hum Immunol. 2019;80:335-338.

PDF

Version 1

posted 31 Dec, 2019

You are reading this latest preprint version

Correlation of tumor necrosis factor-α -308G>A polymorphism with susceptibility, clinical manifestations and severity in Behçet syndrome: evidences from an Italian genetic case-control study

Status:

Version 1

Abstract

Background

Methods

Results

Discussion

Conclusions

List Of Abbreviations

Declarations

References

Status:

Version 1