Patients and tissues
Ovarian serous cancer tissue samples were collected from a total of 40 patients from 2017-2020 in Department of Gynecology and Obstetrics of Shengjing Hospital of China Medical University. At least two pathology experts jointly determined the postoperative pathology of in all the cases. Of these, 30 chemo-resistance cases and 102 chemo-sensitivity cases were determined according to NCCN guidelines. All patients have provided signed the informed consent and the experimental protocol was approved by the Institutional Medical Research Ethics Committee of the Shengjing Hospital of China Medical University(2020PS274K-X1).
Cell culture
SKOV3 and 293T was obtained from the were acquired from the Tumor Cell Bank of the Chinese Academy of Medical Sciences (Beijing). The PTX-resistant OC cell line, SKOV3-TR30 was derived from SKOV3 and provided by Zhejiang University affiliated Obstetrics and Gynecology Hospital (Hangzhou). SKOV3 and SKOV3-TR30 cell lines were cultured in RPMI 1640 (Hyclone, USA). SKOV3-TR30 cells were maintained with the addition of 20 nM of PTX (Sigma Aldrich, MO). 293T cells were cultured in DMEM (Hyclone, USA). All the medium contains 10% fetal bovine serum (FBS, Procell) and 1% penicillin/streptomycin. Cells were cultured at 37°C with 5% CO2.
Real-time PCR(RT-PCR)
Total RNA was isolated using Trizol reagent (Invitrogen). cDNA was synthesized according to the manufacturer’s protocol (Takara). SYBR premix Ex TaqTM II (Takara) was used for PCR. The primers were synthesized by Sangong (Shanghai, China) and shown as follows: PRPF6: forward: GAGGATGCTGACAGTTGTGTAG, reverse: CCATGGTTCTTCTCGAAGTACG; SNHG16-L: forward: CCAGTTACACAGGATGCCGTCTTG, reverse: AGCTGATTGCCTTGGTGAGTCAAC; SNHG16-S: forward: GCCAAGGTGAAGCGAGCTGAG, reverse: GCAAGAGACTTCCTGAGGCACAT; CEBPB: forward: GCACAGCGACGAGTACAAGA, reverse: TGCTTGAACAAGTTCCGCAG; GATA3: forward: GTCCTGTGCGAACTGTCAGA, reverse: CGAGCTGTTCTTGGGGAAGT. The relative expression of RNAs was normalized by 2-△△CT method.
Cell transfection
si-RNAs were synthesized from Ribobio (Guangzhou, China). The sequences were as follows: si-PRPF6-001: GAAGCGGGTTCTTCGGAAA, si-PRPF6-002: GGATCTAAATGACACCAAT, si-PRPF6-003: CTCGGAACCTTATCATGAA. The overexpression plasmids pHBLV-PRPF6, pcDNA3.1-SNHG16-L, pcDNA3.1-SNHG16-S, pcDNA3.1-CEBPB, and pHBLV-h-GATA3 were synthesized from Hanbio (Shanghai, China). Lipofectamine 3000 (Invitrogen) was used transfection according to the instructions.
Transwell assay
5*104 cells were suspended in a serum-free medium and plated on upper transwell migration chambers (Corning Costar). Transwell invasion assay was coated with Matrigel (BD). The lower chambers added medium with 10% FBS. After cultured 48h, the membranes were fixed with methanol and stained with 1% crystal violet. Five random fields (×400 magnifications) were counted and photographed under the light microscope.
Cell Counting Kit-8 (CCK8) assay and cell viability assay
50000 cells were seeded in 96-well plate with 100ul medium per well. We added 10ul CCK8 reagent (Sigma) at 0,24,48,72 and 96h. The optical density was measured at 450 nm. For cell viability assays, we added various concentrations of PTX after seeded for 24h. Then, added 10ul CCk8 reagent at 48h and examined in 2 hours.
Colony Formation Assay
Transfected OC cells were plated in 6-well plates and incubated for 10 days (1000 cells/well). Then the cells in the well were fixed with methanol and stained with 0.1% of crystal violet. Then calculated by counting the number of visible colonies.
Cell apoptosis assay
Cells were digested with EDTA-free trypsin. The cells were stained with Annexin V-FITC/PI or Annexin V-PE/7-AAD (for cells transfected with green fluorescence plasmid) (BestBio). Flow cytometry was used to analysis apoptosis.
Western blot
Total protein was extracted via RIPA lysis (Beyotime) with phenyl-methane-sulfonyl fluoride and protease inhibitor. 10% SDS-PAGE gel electrophoresis with 30µg protein per well was performed and then we transferred PVDF membranes. Antibodies PRPF6 (1:2000, Abcam), CEBPB (1:2000, Abcam), GATA3(1:2000, Abcam), Vimentin (1:1000, Elabscience), E-cadherin (1:1000, Elabscience), N-cadherin (1:1000, Elabscience), β-tubulin III (1:2000, Immunoway), β-actin (1:5000, Bioworld) were incubated overnight at 4℃.
RNA immunoprecipitation (RIP)
The experiment was conducted followed the manufacturer’s protocol of Magna RIP kit (Millipore). The antibodies used for RIP were PRPF6(10ug per reaction, Abcam) and CEBPB (10ug per reaction, Abcam). RNA was extracted after detachment from the bead using protease K. The expression of SNHG16 pre-mRNA, SNHG16-L and SNHG16-S was determined using RT-qPCR.
Chromatin immunoprecipitation (ChIP)
ChIP was performed according to the instructions of EZ ChIP KIT(Millipore). The antibodies used for ChIP were CEBPB (10ug, Abcam). The possible binding sites of CEBPB and GATA3 promoter were predicted via Jaspar, and specific primers were synthesized by Sangong (Shanghai, China), sequences were as follows: GATA3 promoter: forward: CAAGCCCTTTGCCCCAT, reverse: CAGGTAGAGTTTTCCCTTCACAA. The enrichment of GATA3 promoter was detected by RT-PCR.
Dual-luciferase reporter gene assay
The luciferase plasmids pSI-Check2-GATA3 wild type/mutant type(wt-GATA3/mut-GATA3) were synthesized by Hanbio (Shanghai, China). According to the instruction of Dual-Luciferase® Reporter Assay System (Promega), the luciferase activity was detected.
Immunohistochemistry (IHC)
The paraffin sections were deparaffinized and antigen retrieval was performed by adding citrate buffer (pH 6.1). The sections were then incubated with PRPF6 antibodies (Abcam, 1:250) were diluted in 5% BSA, followed by DAB staining (Elabscience) and observation under microscope.
Immunofluorescence (IF)
Cells growing on coverslips in 6-well plates were removed and fixed with 4% paraformaldehyde. Then, permeabilized in 0.5–1.0% Triton X-100 for 10 min and blocked with 5% BSA for 30 minutes. The cells were then incubated with antibodies PRPF6 (1:150, Abcam), CEBPB (1:150, Abcam), GATA3(1:150, Abcam) overnight at 4℃. Fluorescent-labelled secondary antibody (1:100, Proteintech) was added and incubated in the dark for 2h. Cells were stained with DAPI and observed under the fluorescent microscope.
Fluorescence in situ Hybridization (FISH)
Cells growing on coverslips in 6-well plates were removed. The SNHG16 probe were synthesized by Servicebio. The experiment was operated according to the protocol of Fluorescent in Situ Hybridization Kit (Ribobio). The slips observed under the fluorescence microscope.
Xenografts in nude mice
The lentivirus containing siPRPF6 sequence was synthesized by Gene-Pharma (Shanghai, China). The SKOV3-TR30 cells were infected with lentivirus and obtained stably transfected cells. 4-weeks-old female BALB/cA-nu Mice(N=3/group) were purchased from Huafukang (Beijing, China). The mice subcutaneously inoculated with stable transfected cell suspension (200 µL, 5 × 106cells) into dorsal part to observe tumor growth. After 1 week, PTX (20 mg/kg) or saline was injected into tumor every 3 days for 3 weeks when tumor size reached 80-100mm3. Animal experiments were performed according to the ethical guidelines for animal experiments and were approved by China Medical University Animal Welfare and Ethical Community (CMU2020341).
Statistical analysis
The statistics were analyzed with SPSS 22.0. The results represented as the mean± standard deviation (SD). Data with normal distribution and homogeneity of variance were compared by paired sample t-test or non-paired t-test. One-way analysis of variance (ANOVA) was used for comparison among multiple groups. Repeated measures ANOVA, followed by the Bonferroni post hoc test, were used to analyze multiple groups at different time points. Significantly difference was set as P<0.05.