Clinical samples and data acquisition
Transcriptome RNA-sequencing data of hepatocellular carcinoma (HCC) samples were downloaded from the TCGA data portal (https://cancergenome.nih.gov/), which contained data from 374 primary HCC and 50 non-tumor tissues. Raw count data was downloaded for further analyses. To selected genes involved in the onset of HCC, differentially expressed genes between HCC and non-tumor tissues were screened via the R software Linear Models for Microarray and RNA-Seq Data (Limma) package (http://bioconductor.org/packages/Limma/). We performed differential gene analysis of all transcriptional data, setting a log2 |fold change| > 1 and a false discovery rate (FDR) < 0.05 as the cutoff values. The Wilcox-test was used for analyses.
Immunohistochemical (IHC) staining
The HCC cancer tissues and matched adjacent tissues (at least 2cm from the surgical incision) were collected from 87 patients with hepatocellular carcinoma who were surgically resected at Fudan University Shanghai Cancer Center from January 2016 to December 2018. All specimens were confirmed by pathological diagnosis. No patients received radiotherapy or chemotherapy before surgery. These tissues were placed in liquid nitrogen and then transported to -80 ℃ refrigerator for storage. Written informed consent was obtained from each patient before sample collection, and the study protocol was approved by the Medical Ethics Committee of Fudan University Shanghai Cancer Center. These 87 HCC clinical samples were fixed in 4% paraformaldehyde (PFA), embedded in paraffin, sectioned and stained with haematoxylin and eosin. IHC staining of the paraffin-embedded tumor tissues was performed using anti-FBXL6 and anti-HSP90AA1 antibodies. We have added these information in the revised manuscript.
Cell culture and reagents
HEK293T cells and hepatocellular carcinoma cell lines SMMC-7721 and Hep3B cells were purchased from American Type Culture Collection (ATCC). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen), supplemented with 10% FBS (Gibco), 100 units/mL penicillin, and 100 mg/mL streptomycin (Gibco). MG132 and Cycloheximide (CHX) were purchased from Sigma.
Plasmids
F-box protein genes were amplified from 293T or SMMC-7721 cells by polymerase chain reaction and cloned into pbabe-Flag vector. pCherry.90 alpha was a gift from Didier Picard (Addgene plasmid # 108222 ; http://n2t.net/addgene:108222 ; RRID:Addgene_108222). c-myc-PT3EF1a was a gift from Xin Chen (Addgene plasmid # 92046; http://n2t.net/addgene:92046 ; RRID:Addgene_92046). pRK5-HA-Ubiquitin-K63 was a gift from Ted Dawson (Addgene plasmid # 17606 ; http://n2t.net/addgene:17606 ; RRID:Addgene_17606). All plasmids were completely sequenced and transfected into cells by using Lipofectamine 2000 (Invitrogen) according to manufacturer’s instructions.
RNA interference, RNA isolation and real-time PCR
The Lentiviral Human FBXL6 shRNA was purchased from Merck and the target sequences for short hairpin RNA (sh-RNA)-expressing plasmids were the following: FBXL6-shRNA1: CACCGGCATCAACCGTAATAG; FBXL6-shRNA2: TGGAGTGGCTTATGCCCAATC. Total RNA of cell lysate was extracted by using TRIzol reagent (Invitrogen, Shanghai). Oligo dT was used to prime cDNA synthesis. Real-time PCR was then performed by using a SYBR Green Premix Ex Taq (TaKaRa) on Light Cycler480 (Roche, Switzerland). GAPDH was used as internal control. Differences in gene expression were calculated using 2-ΔΔCt method. Primers used for qPCR analysis were list as follows: FBXL6 forward, 5’- GGAGACCGCATTCCCTTGG-3’; reverse, 5’- AAAACCGATTGGGCATAAGCC-3’. HSP90AA1 forward, 5’- AGGAGGTTGAGACGTTCGC-3’; reverse, 5’- AGAGTTCGATCTTGTTTGTTCGG-3’. GAPDH forward, 5’- TGTGGGCATCAATGGATTTGG -3’; reverse, 5’- ACACCATGTATTCCGGGTCAAT -3’.
CRISPR/Cas9 knock out (KO) cell lines.
SMMC-7721 cells were transfected with FBXL6 CRISPR/Cas9 KO (h) KO plasmid (sc-408853, Santa Cruz Biotechnology) using Lipofectamine2000 following the manufacturer’s instructions. Cells were selected with 1 µg/ml puromycin two weeks. Single clones were then selected and the knockout efficiency was verified by western blot assay.
Western blotting and antibodies
Cells were lysed with lysis buffer (100 mM Tris-HCl, pH 6.8, 100 mM DTT, 1% SDS, 10 % glycerol). Proteins were separated by 10-12% SDS-PAGE, and transferred to NC membrane. Membranes were blocked in 5% non-fat milk in phosphate-buffered saline (PBS) for 1 h before incubation with primary antibody overnight at 4 °C. Membranes were washed with and incubated with secondary antibody for 1 h. Primary antibodies used as indicated: anti-Flag M2 (1:4,000 dilution, F1804, Sigma), anti-HSP90AA1 (1:1,000 dilution, 13171-1-AP, Protein tech), anti-FBXL6 (1:1,000 dilution, SAB1407299, Sigma), anti-Cul1 (1:1000 dilution, sc-17775, Santa cruz, U.S.A), anti-SKP1 (1:2,000 dilution, #12248, Cell Signaling Technology, U.S.A), anti-c-Myc (1:1,000 dilution, #18583, Cell Signaling Technology, U.S.A), and anti-GAPDH (1:5,000 dilution, #5174, Cell Signaling Technology, U.S.A).
Immunoprecipitation (IP) and Mass spectrometry (MS)
Cells were lysed with IP buffer (100 mM NaCl, 20 mM Tris-cl PH8.0, 0.5 mM EDTA, 0.5 % (v/v) Nonidet P-40) with protease inhibitor cocktail and phosphorylate inhibitor for 30 min on ice. Cells were sonicated and the lysates were centrifuged. The supernatant was incubated with appropriate antibodies and protein A/G beads overnight at 4 °C in a rotating wheel. Immunoprecipitates were washed with IP buffer. SDS loading buffer was then added and proteins were eluted by boiling at 95℃for five minutes. For mass spectrometry assay, lysates from 293T cells transfected with Flag-con or Flag-FBXL6 were cleared by centrifugation at 15,000 g for 20 minutes at 4°C to remove cell debris. The resulting lysates were subjected to IP with Flag M2 beads overnight at 4°C. Bound proteins were eluted by boiling, resolved by SDS-PAGE and stained with coomassie blue staining, followed by mass spectrometry analysis.
In vivo Ubiquitination assay
Cells co-transfected His-K63-Ubiquitin with EV or Flag-FBXL6 plasmids were sonicated in IP buffer containing 8M urea and 10mM imidazole. His-K63-Ubiquitin-conjugated proteins were recovered with Ni-NTA resin (Qiagen), washed eight times in urea lysis buffer containing 20mM imidazole, and eluted with IP buffer containing 5% SDS and 200mM imidazole. The boiled samples were separated by 10% SDS–PAGE and subjected to western blot with antibodies as indicated. For endogenous ubiquitinated protein accumulation, Tandem Ubiquitin Binding Entity 2 (TUBE2) resin (LifeSensors) was used. Cells were lysed with IP buffer with protease inhibitor cocktail and phosphorylate inhibitor for 30 min on ice. Cells were sonicated and the lysates were centrifuged. The supernatant was incubated with TUBE2 resin overnight at 4 °C in a rotating wheel. The resin was then washed with IP buffer and boiled in SDS loading buffer. Boiled samples were separated by 10% SDS–PAGE and subjected to western blot with antibodies as indicated.
Colony formation analysis
Cells were seeded in a six-well plate at a density of 1000/well and then cultured for 2 weeks. The numbers of colonies containing more than 50 cells were counted by crystal purple staining.
Apoptosis analysis
Cells were seeded into 6 well plates. Apoptosis cells were determined using Annexin V–fluorescein isothiocyanate (FITC) and propidium iodide (PI) apoptosis detection kit according to the manufacturer’s instruction. Cell apoptosis was then analyzed using a FACS Calibur flow cytometer (BD Biosciences, San Jose, CA, USA). Apoptosis was also determined by measuring the activity of the caspases 3 and 7 using a luminescent substrate (Caspase-Glo 3/7; Promega) according to manufacturer’s instructions.
Luciferase reporter and chromatin immunoprecipitation assays
The promoter region of FBXL6 gene was amplified from the human genomic DNA and inserted into pGL4.15 vector (Promega, Madison, Wisconsin, USA). For the luciferase reporter assays, HEK293T cells were seeded in 24-well plates and transfected with the indicated plasmids using Lipofectamine 2000 (Invitrogen) for 36 hours. Luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega). The firefly luciferase luminescence data were normalized by the Renilla luciferase luminescence data. A chromatin immunoprecipitation (ChIP) assay kit (Upstate, Billerica, MA) was used according to manufacturer instructions. Briefly, cells were fixed with formaldehyde and DNA was sheared to fragments at 200-1,000 bp by repeated sonication. Chromatin was then incubated and precipitated with antibodies against c-Myc or IgG. Primers for GAPDH were used as negative control.
Xenograft assays
Animal study was approved by Animal Care and Use Committee of Fudan University Shanghai Cancer Center. 8-week-old male BALB/cA nude mice were purchased from National Rodent Laboratory Animal Resources (Shanghai, China). All mice were kept in a specific pathogen-free facility and housed at 21 °C ± 1 °C with humidity of 55 ± 10%, fed with sterilized food and water, and kept on a 12 h light/dark cycle. FBXL6+/+and FBXL6-/- SMMC-7721 cells at a density of 1×107 were suspended in 50 µl of DMEM medium, mixed 1:1 with Matrigel (Corning) and injected into the flanks of male nude mice. Tumor sizes were measured by a caliper and calculated using the formula length × width 2 × 1/2. Tumor weights were measured after mice were sacrificed.
Statistical analyses
All experiments were at least repeated three times. Data are presented as mean ± standard deviation (SD). Statistical analysis was performed with GraphPad Prism 7.0 software. The differences between groups were calculated using the Student's t-test or one-way ANOVA using a Tukey post-hoc test. P values of <0.05 were considered statistically significant. Statistical significance is displayed as * P < 0.05, ** P < 0.01, and *** P < 0.001, respectively.