Plasmid construction`
MYOD1- Knock-out and Knock-in plasmids: Using the chMYOD1 sequence obtained from the NCBI database (Accession: NC_006092.5), we designed gRNA sequences targeting exon1 of chMYOD1, known as sgRNA1: CGACCCGTGCTTCAACACGT and sgRNA2: GCGGCTCAGCAAGGTCAACG. We synthesized the oligo-DNAs corresponding to these gRNAs. We annealed them to a T7 promoter-driven Cas9 and to a U6 promoter-driven gRNA vector in order to obtain two gRNA-expressing plasmids. In order to construct the MYOD1-over-expression vector, the full-length coding sequence of chMYOD1 (NCBI Reference Sequence: NM_204214.2) was amplified from chicken subcutaneous adipose cDNA by PCR, and cloned into the CMV promoter-driven piggyBac and an EF1α promoter-driven GFP plasmid by replacing GFP using EcoRI and SalI (New England Biolabs, Ipswich, MA, USA). Above plasmids were a gift from Professor Sen Wu (State Key Laboratory of Agrobiotechnology, College of Biological Sciences, China Agricultural University).
pmirGLO dual-luciferase reporters: The 3′-UTR fragment of KLF4 (NCBI Reference Sequence: XM_004949369.3) containing the binding sites were amplified by PCR from chicken subcutaneous adipose cDNA and then cloned into pmirGLO vector. The mutant vectors were constructed by PCR mutagenesis. Six seed sequences were successfully mutated from CATTCC to GTGAAG for the KLF4-3′-UTR vector.
Gene over-expression vector: The MYOD1 and KLF4 over-expression vector was constructed according to the user manual of the Easy Ligation Kit (Sidansai, Shanghai, China). MYOD1 and KLF4 coding sequence (NCBI Reference Sequence: NM_204214.2 and XM_004949369.3) were amplified from chicken subcutaneous adipose cDNA by PCR. The PCR product was cloned into the pcDNA3.1 vector. The successful MYOD1 and KLF4, over-expression vector, was confirmed by DNA sequencing.
miR-206 promoter reporter plasmid: A 1876 bp fragment of the miR-206 promoter was isolated by PCR using the primers listed in Tab. S1. After the PCR product was digested with KpnI and SmaI restriction sites, the insertion was ligated into the pGL4.1 vector (Promega, Madison, WI, USA) to create the expression vector pGL4.1(-1876). After pGL4.1(-1876) was sequenced, this construct was used as a template, and pGL4.1(-1234) was isolated by PCR. All cloning plasmids were confirmed by sequencing.
RNA extraction, cDNA synthesis, and quantitative real-time PCR
Total RNA was isolated from the cells using RNAiso reagent (Takara, Otsu, Japan) according to the manufacturer's instruction. According to the manufacturer's manual, the reverse transcription reaction for mRNA was performed with PrimeScript RT reagent Kit (Perfect Real-Time) (Takara, Otsu, Japan). The reverse transcription reaction for miRNA was using miRNA First-Strand cDNA Synthesis SuperMix (Transgen, Beijing, China). The specific qRT-PCR Primer of mRNA and miRNA were designed using Primer 3 software (version 0.4.0, Howard Hughes Medical Institute). Primer sets are listed in Tab. S1. With KAPA SYBR FAST qPCR Kit (KAPA Biosystems, MA, USA), qPCR program was carried out in ABI-7500 PCR machine (Applied Biosystems, MA, USA), and the method was as described [23]. All reactions were run in triplicate.
Cell culture
A cell line of immortalized chicken preadipocytes (ICPs) [24] was a kind gift of the Poultry Breeding Group of the College of Animal Science and Technology, Northeast Agricultural University, and was cultured in DMEM/F12 (Gibco, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT, USA), and 0.2% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). To induce ICPs differentiation, we added 160 µM sodium oleate (Sigma Life Science, St. Louis, MO, USA) to the medium [25].
For MYOD1OE and MYODKO cells selection, ICPs were seeded in 6-well plates for further transfection using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). After a 48 h recovery period, the cells were supplemented with 3 µg/mL of puromycin (Sigma-Aldrich, MO, USA) in the culture medium for 12 days until clone formation. Cells were harvested using 0.25% trypsin/EDTA (Gibco, Gaithersburg, MD, USA), and the cell density was calculated using a handheld automated cell counter (Millipore, Darmstadt, Germany). Single cells were plated in each well of a 96-well plate by limiting dilution and then cultured for 10 d in the cell culture medium. The medium was replaced every 4 d. Confluent cell colonies were propagated and genotyped by PCR and sequencing.
Transfections
Transfections were performed with Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's direction. Nucleic acids were diluted in OPTI-MEM Medium (Gibco, Gaithersburg, MD, USA). All experiments were carried out at least three times independently.
Oil Red O staining and quantification
The cells were washed with PBS and fixed in 4% formaldehyde for 10 min. Then the cells were stained with Oil-Red-O working solution (Solarbio, Beijing, China) according to the manufacturer's manual. After another wash with PBS, the cell nuclei were counterstained with Hoechst 33342 (Solarbio, Beijing, China). Morphological changes were observed and photographed under an inverted fluorescent microscope (Nikon). The Oil-Red-O dyes were then extracted in isopropanol solution containing 4% Nonidet P-40 and quantified by NanoDrop 2000C spectrophotometers (Thermo Fisher Scientific, San Jose, CA, USA) at 510 nm.
RNA oligonucleotides
The miR-206 mimics, negative control (NC) mimic, miR-206 inhibitors and NC inhibitor were all purchased from GenePharma (GenePharma, Shanghai, China).
Dual-luciferase reporter assay
For the promoter activity assays, ICPs were cotransfected with reporter plasmid and MYOD1 over-expression vector or control vector, and the TK-Renilla reporter was also cotransfected to each sample as an internal control using the Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) in 48-well plates. The miRNA target verification assay was also performed in ICPs. Wild-type or mutant KLF4-3′-UTR dual-luciferase reporter (200 ng) and miR-206 mimic or NC mimic (50 nM) were cotransfected into ICPs. After 48 h transfection, cells were washed by PBS twice, and the activities of Firefly and Renilla luciferase were measured according to the manual of Luc-pair Duo-Luciferase Assay Kit 2.0 (GeneCopoeia, Rockville, MD, USA). All the data were acquired by averaging the results from three independent repeats.
Western blot
Cultured cells were washed with PBS and homogenized with RIPA buffer (Beyotime, Jiangsu, China) containing protease inhibitor cocktail (Beyotime, Jiangsu, China). Protein concentrations were determined using the BCA Protein Assay Kit (Beyotime, Jiangsu, China). Proteins were denatured and subjected to 10% polyacrylamide gel and transferred to methanol-activated PVDF membranes. Blots were probed using the primary antibodies: mouse anti-MYOD1 (1:500; Santa Cruz Biotechnology, USA, Cat# sc-377460), rabbit anti-KLF4 (1:500; Bioss, Beijing, China, Cat# 52850R), mouse anti-GAPDH, (1:5000; Bioworld, St Louis Park, MN, USA, Cat#MB001), overnight at 4 °C. After one h incubation with anti-mouse or anti-rabbit HRP‐conjugated second antibody (1:5000, Bioss, Beijing, China, Cat# 40296G, 40295G). Immunodetection was performed using enhanced chemiluminescence (ECL) Western blotting substrate (Beyotime, Jiangsu, China) and detected with FluoChem R imaging system (ProteinSimple, CA, USA).
RNA-seq analysis
Raw reads were trimmed to remove adapters and low-quality reads, with Trimmomatic (version 0.39) [26]. Trimmed reads were mapped to the chicken reference genome (Ensembl release 100:ftp://ftp.ensembl.org/pub/release100/fasta/gallus_gallus/dna/Gallus_gallus.GRCg6a.dna.toplevel.fa.gz) using HISAT2[27]. Read counts for each gene were calculated using Stringtie (v.2.1.2) and normalized by library sequencing depth using the R package DESeq2 (v.1.28.1) after filtering the gene with low expression [28]. We used the DEGSeq2 (v.1.28.1) package to identify DEGs between MYOD1NC, MYOD1KO, and MYOD1OE cells at different days (day 0 and day 5). Therefore, samples were excluded from further analysis due to its low global Pearson correlation with the other repeat samples (R2 < 0.95). Genes with |log2FC|≥ 0.585 (or ≥ 1) and the Benjamini༆Hochberg (BH) adjusted p-value (adjusted-P value) < 0.05 were considered as differentially expressed genes.
Functional enrichment and prediction of miRNA target genes
Genes were annotated with gene Symbols from the Uniprot database for functional annotation. Gene ontology (GO) analysis of the enriched genes was performed using the web-based Metascape [29] (a gene annotation & analysis resource, http://metascape.org/gp/index.html#/main). Putative miRNA targets for miR-206 were predicted by online software, TargetScan (version 7.2, http://www.targetscan.org/), miRDB (http://mirdb.org/) as well as miRTarBase (http://mirtarbase.cuhk.edu.cn/) to choose target genes for validation.
Statistical analysis.
Each experiment was repeated three times, and all results are represented as the mean ± SD. Three independent sample t-test was used to perform the statistically significant difference between groups. The level of significance was presented as ∗ (p < 0.05).