Materials
The antibodies used for detection of proteins of interest were 6E10 (against Aβ1–16) from Covance, R1 (57) against the carboxy terminus of APP was a kind gift from Dr P. Mehta (NYS Institute for Basic Research in Developmental Disabilities); anti-BACE1 was from Cell Signaling; anti-apolipoprotein E (ApoE) and anti-neprilysin CD10 from Santa Cruz; anti-ionized calcium-binding adapter molecule 1 (IBA1) from Wako; anti-glial fibrillary acidic protein (GFAP) (clone 2.2B10), anti-Aβ (6C3) and anti-neuronal nuclei (NeuN) were from Millipore; anti-insulin degrading enzyme (IDE), Aldehyde dehydrogenase 1A (Aldh1a1) and anti-β-actin were from Abcam.Tissue culture reagents were purchased from Invitrogen and Millipore, and all other reagents were purchased from Sigma, unless stated otherwise.
Animal Models
5XFAD transgenic (Jackson Laboratory) 7 day old pups were used for organotypic cultures, overexpressing in their brains human APP (695) with the Swedish (K670N, M671L), Florida (I716V), and London (V717I) mutations, as well as human PS1 with the mutations M146L and L286V (21). 5XFAD mice were used because their phenotype is more aggressive than other transgenic models of amyloidosis and allow the detection of pathological changes in brain slices after only two weeks in culture. Thy-1-GFP transgenic 7 day-old pups were used for organotypic cultures, expressing membrane-bound GFP (22).
Mice were kept in individually ventilated cages and maintained on a 12/12 h light/dark cycle with controlled temperature and humidity, and food and water ad libitum. In vivo procedures (breeding) were performed in accordance to the United Kingdom Animal (Scientific Procedures) Act (1986) and approved by Imperial College London’s Animal Welfare and Ethical Review Body.
Organotypic Brain Cultures
Organotypic brain culture slices (OBCSs) were prepared from postnatal day (P)7 from wild-type, 5XFAD, Thy-1-GFP and double transgenics Thy-1-GFP/5XFAD mice. Brains were sectioned in 300 µm coronal slices using a vibratome (Leica VT1200 S); sections were then mounted on semi-porous membrane filters (Millipore). Brain slices were maintained in culture for two weeks in nutrient media (Neurobasal-A medium (Invitrogen), 20% Normal Horse Serum, 20% HBSS, 0.5% glutamine, 0.5% vitamin B27 supplement and 1% antibiotics), and incubated at 37 °C, 95%HR, 5%CO2. The nutrient medium was replaced every 2 days for 2 weeks. Slices from 5XFAD mice were treated for 24 h with vehicle or with 1 mM L-AAA (Sigma) (18) in nutrient media. In another set of experiments, WT OBSCs were treated with vehicle or 0.6 µM synthetic Aβ42 (23) (Anaspect). After incubation, media was collected and brain slices were either homogenized or fixed in 4% PFA for 24 h and kept at 4 °C in PBS and Na-azide.
Western blot
Brain slices were homogenized in RIPA buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, and 50 mM Tris-HCl, pH 7.2) supplemented with cOmplete protease inhibitor (Roche) and phosphatase inhibitor (Roche). 50 µg of protein either from homogenates or conditioned media were run on 4–12% Tris-tricine gels (NuPAGE gels, Invitrogen). After transferring the gel to PVDF or nitrocellulose (for Aβ) membranes, the membranes were blocked with 5% non-fat semi skimmed milk diluted in Tris-buffered saline with Tween (TBST) for 1 hour. The primary antibody, diluted in 1% BSA and Na-azide was subsequently incubated overnight at 4 °C. The horseradish peroxidase secondary antibody was incubated in 5% non-fat semi skimmed milk for 1 hour at room temperature and bands were visualized using ECL with a Gengnome XRQ device. Western blots were analysed using the ImageJ software and values were normalised using β-actin as loading control.
Enzyme-linked Immunosorbent Assays (ELISA)
The levels of human Aβ40 and Aβ42 were determined in homogenates using the High Sensitivity Human Amyloid β42 and Aβ40 ELISA kits from Millipore. For the analysis of mouse cytokines and chemokines in conditioned media from the cultures, we used kits from Peprotech (IL-1β, TNFα and IL-4) and Meso Scale Discovery (Europe) (IL-6, IL-10, TGF-β1, MCP-1 and MIP-1α). Concentrations were quantified according to the manufacturer’s instructions and normalised to total protein concentration.
RNA Extraction And Quantitative PCR
mRNA extraction was conducted using the mirVana™ microRNA (miRNA) Isolation Kit according to manufacturer instructions (Thermofisher). Organotypic slices were homogenized in Precellys tubes using a MiniLys homogenizer (Bertin Technologies).
Polymerase chain reaction Real-time cycling was carried out with PowerUp™ SYBR™ Green Master Mix (Thermofisher) and Quantitect Primer assays (Qiagen) for mouse Neprilysin (Mme, Qiagen), IDE (5’-CAGAAGGACCTCAAGAATGGGT-3’ and GCCTCGTGGTCTCTCTTTATCT) and ApoE (Primers: 5’-GGGACAGGGGGAGTCCTATAA-3’ and 5’-ATTGGCCAGTCAGCTCCTTC-3’) and normalized to GAPDH (5’-ACCACAGTCCATGCCATCAC-3’ and 5’- TCCACCACCCTGTTGCTGTA-3’). A 2-step method with an initial reverse transcription and subsequent real-time cycling on an Aria Mx qPCR workstation cycler was performed, as reported previously (17).
Propidium Iodide (PI) Staining
PI was added at a concentration of 5 µg/ml, incubated for 30 minutes in the conditioned media and imaged with a confocal microscope.
Immunofluorescence Staining
Brain sections were permeabilised overnight in 0.25% TBS-TX (TBS with triton X-100). Following this, sections were washed again in TBS and blocked for 60 minutes in 10% Goat serum/1%BSA in 0.1% TBS-TritonX and incubated with the primary antibodies (anti-GFAP, 1:500, anti-NeuN 1:500, anti-IBA1 1:500, anti-ALDH1L1 1:500, anti-6C3 1:500) diluted in 2% Goat serum, 0.2% BSA in TBS-TX 0.02% for 48 h at 4 °C. Following this, sections were washed 5 times for 10 minutes in TBS and incubated with the secondary fluorescent antibodies (1:400 Alexa Fluor; Invitrogen) in 2% Goat serum, 0.2% BSA in TBS-TX 0.02% overnight at 4 °C. After incubation with the secondary antibodies, sections were washed 4 times with TBS for 10 minutes. In the final wash Hoechst solution (for nuclear visualisation) was added (1:1000 in TBS) for 5 minutes. Following this, the slices were washed and mounted using ProlongTM Gold antifade reagent (Invitrogen). Sections were visualised with a confocal microscope (Zeiss LSM-780). Immunohistochemistry staining was quantified using the HALO software (Indico Labs) using the Area Quantification FL module and represented as percentage of the total image area.
Quantification Of Dendritic Spines And Analysis Of Microglia
Dendritic spine size and density: Spine size was calculated as integrated brightness, using an adapted version of custom written Matlab code, as described previously (24, 25). Briefly, spine intensity was measured by first drawing a region of interest (ImageJ) across a length of dendrite taken from confocal z-stacks. The region of interest covered the spine protrusions and a section of the adjacent dendrite. The region of interest was then used to measure the fluorescence intensity profile of the spines and adjacent dendrite. The background was subtracted, and the intensity profile was normalized to the adjacent dendrite to account for differences in image intensity and background noise between acquired z-stacks using MATLAB. A custom written peak detection code (MATLAB) was then used to identify fluorescence peaks in the normalized intensity profile corresponding to individual spines. To identify peaks, a threshold (50% greater than adjacent dendritic fluorescence) was set based on visual inspection of the smallest detectable spine peak. The number of spine peaks was then divided by the length of the dendrite to estimate the spine density and confirmed by manually counting spines along 3-dimensional dendritic path-lengths using ImageJ. For each spine, the area under the normalized fluorescence spine peak (measured in normalized dendrite units) was used as a proxy for spine size.
Microglia analysis: For microglia analysis, a fluorescence intensity profile, taken from a maximum intensity projection, was drawn through the longest dimension of the cell body and across a cross-section of the outer most tips of all associated processes. This intensity profile was then used to estimate the soma size as well as the number, area and the perimeter of processes using custom written code in MATLAB. Soma size was estimated by normalizing the portion of the fluorescence trace corresponding to the soma to the background, and then calculating the area under the curve for this section by multiplying the fluorescence peak by the width. The number of branch processes was estimated by using custom written code (MATALB) to detect peaks that were 25% greater than background (threshold derived from visual inspection). These peaks were then used to estimate the process area by calculating the area under each fluorescence peak and summing these values. Finally, the total process perimeter was calculated by adding the total number of pixels covered by all detected peaks and dividing this number by the scaling factor or the image (pixels/µm).
Statistical analysis
We calculated the number of animals and group sizes to be used via InVivoStat, an R-based statistical package (26). The data was analysed using Graphpad Prism 8 software (Graphpad Software Inc), using unpaired Student t tests, repeated-measures 1- or 2-way analyses of variance, and followed by Tukey post hoc analysis. The Kolmogorov-Smirnov test was applied to confirm normal distribution. All quantitative data are given as mean ± SEM. Probability of less than 0.05 was considered significant.