2.1 Animals
Sprague Dawley (SD) rats, male, 8 weeks old, weighing 230-250g, were provided by the Animal Experiment Center of the Naval Medical University. All experimental operations strictly abided by the Guide for the Care and Use of Laboratory Animals published by US National Institutes of Health (NIH publication No.85-23, revised 1996) and were approved by Animal Care and Use Committee of the Naval Medical University. During this process, efforts were made to minimize the pain and number of animals used.
2.2 Experimental design
2.2.1 To explore the formation of NETs and the law of sympathetic excitability after TBI, 75 male SD rats were randomly divided into control group (n = 30) and experimental group (n = 45). After DAI attack, 30 surviving rats were randomly selected from the experimental group for further experiments. The experimental procedure of the control group was consistent with that of experimental group, except for the DAI attack. Both groups were equally divided into 5 subgroups (n=6) according to different time points (24 hours, 48 hours, 72 hours, 120 hours, 168 hours). The heart rate variability (HRV), arterial blood pressure (BP) and serum catecholamine (CA) concentration were measured and analyzed at the different time points. Brain tissue was harvested for pathological observation, including immunohistochemical staining of β-amyloid precursor protein (β-APP), HMGB1 and AP1, dual immunofluorescence staining of CitH3-MPO and Western bolt of IL-1β.
2.2.2 In in vitro experiment, cells were divided into solvent control group and HMGB1 group. Cells in HMGB1 group were added with different concentrations of HMGB1 recombinant protein (10ng/ml, 50 ng/ml, 100 ng/ml, Novoprotein, Shanghai, China), and those in control group were added with the same amount of PBS buffer solution instead. Subsequently, cells were incubated for 24 hours and then collected for detection.
2.2.3 To further confirm the role of HMGB1/AP1 pathway in sympathetic excitability in vivo, 30 male SD rats were randomly divided into sham group (n = 12) and DAI group (n = 18). After DAI attack, 12 surviving rats from DAI group were further randomly divided into DAI+Anti-HMGB1 group (n=6) and DAI+NS (normal saline) group (n=6). Rats in sham group were further randomly divided into sham+HMGB1 group (n=6) and sham+NS group (n=6). The procedure done for rats in sham group was consistent with that of DAI group except for the attack. In 2 DAI subgroups, anti-HMGB1() or NS were injected into the PVN 24 hours after attack. Meanwhile, the 2 sham subgroups were injected with HMGB1 or NS 24 hours after sham operation. HRV, blood pressure and serum CA, AP1, IL-1β in PVN were analyzed 72 hours after operation.
2.3 Cell culture and processing
HMC3 microglial cells were purchased from the cell bank of the Chinese Academy of Sciences in Shanghai and seeded on culture format in MEM (Fuheng Biotechnology, phm01, China) supplemented with 1% PBS and 10% fetal bovine serum (FBS, Biological Industries). Cultures were maintained at 37 °C in a 5% CO2 humidified atmosphere for 3 days and then collected for further processing.
To process HMC3 cells, they were seeded on 12-well format in culture medium with different concentration of HMGB1 recombinant protein (0ng/ml, 10ng/ml, 50 ng/ml, 100 ng/ml). After culture for 24 hours, morphologic change of cells was observed.
2.4 DAI and sham-injury
DAI and sham-injury were conducted according to a standard protocol as previously described [20]. Rats were anesthetized with isoflurane and fixed on the DAI device. The head was rotated about 75 degrees (4.68ms, 1.6 × 1.815 rad/s) on the coronal plane, and moved 1.57cm (4.66ms, 3.4 × 102 cm/s) horizontally to realize the angular/linear acceleration and deceleration injury of the brain. Then the tongue of the rat was pulled out with ophthalmic forceps to prevent suffocating. Rats in the control group received anesthesia and were fixed on the same device without the strike.
2.5 Stereotaxic injection administration
After anesthesia with inhaled isoflurane, rats were placed in an animal stereotaxic apparatus (ALCBIO, ALC-H, China). The injection was located −1.8 mm anteroposterior, ±0.4 mm mediolateral, −7.7 mm dorsoventral below the surface relative to bregma. The coordinates were determined based on the atlas of rats [21]. A total of 0.2 μL NS, anti-HMGB1 or HMGB1 was injected into the PVN using a 1-μl microsyringe (GAOGE, Shanghai, China) at a speed of 0.1uL/min. The needle was carefully pulled out after holding it in place for 10 min.
2.6 HRV Monitoring
The HRV analysis system (ALCBIO, MPA-HBBS, Shanghai, China) was used to record the rats’ electrocardiogram (ECG). Animals were anesthetized with inhaled isoflurane in the supine position. The electrode and rat limbs were sterilized with 75% alcohol. The white, black and red recording needles were inserted into the right forelimb, right hindlimb and precordial area subcutaneously. When P, QRS, T and other wave groups can be clearly identified with no interference signal, ECG signal data were recorded for 15 to 30 minutes each time. The frequency domain and time domain were performed with the software of the system.
2.7 Intravascular cannulation
The anesthetized rat was fixed on a constant temperature operating table in the supine position. Polyethylene Catheters (consisting of 5-cm PE-10 tubing tightly bonded to 15-cm PE-50 tubing) were placed in the abdominal aorta by insertion through the femoral artery for the measurement of BP. The catheters were subcutaneously tunneled and exteriorized at the back of the neck between the scapulae. Finally, the catheters were flushed with heparin (0.2 ml, 200 IU/ml) and plugged with stainless steel pins. Incisions were closed by surgical sutures. BP was measured on freely-moving conscious rats 24 hours following the surgery. Briefly, the arterial catheter was connected to a transducer connected with the BP recorder (ALCBIO, ALC-MPA, Shanghai, China). During the process, heparin (20 IU/ml, 0.5 ml/h) was continuously pumped into the catheter to prevent blockage.
2.8 Enzyme-Linked Immunosorbent Assay (ELISA)
Levels of serum CA and IL-1β in culture medium were measured using commercially available CA (JINGMEI Biotechnology, China) and IL-1β (JINGMEI Biotechnology, China) ELISA-KIT according to the manufacturer’s instruction. Each ELISA analysis was conducted in triplicate. To quantify CA and IL-1β levels, the absorbance of samples was read and analyzed at 450 nm on a spectrophotometric plate reader (BioTek Synergy HT, Winooski, USA).
2.9 Western Blot (WB)
The protein concentration was measured with the BCA kit (E112-01, Vazyme, Nanjing, China) according to the manufacturer’s instructions. Lysates were applied to a 10% SDS-PAGE gel and then transferred to PVDF membrane. The membrane was blocked and incubated with primary antibody against IL-1β (1:1000, Zen Bio, 511369, China) or AP1(1:1000, CST, 60A8, USA) overnight at 4℃, followed by incubation with secondary antibodies (1:5000, ThermoFisher Scientific, USA) for 2 hours at room temperature. Finally, the protein bands were visually detected and analyzed. Tubulin served as a loading control.
2.10 Real-Time Fluorescent Quantitative PCR (RT-qPCR)
Total RNA from cell lysates was extracted out and reverse-transcripted into cDNA (321392, Promega, Beijing, China). The sequences of the primer pairs were as follows: C-AP1-F: CCTTGAAAGCTCAGAACTCGGAG; C-AP1-R: TGCTGCGTTAGCATGAGTTGGC; IL-1β-F: CCACAGACCTTCCAGGAGAATG; IL-1β-R: GTGCAGTTCAGTGATCGTACAGG. Then RT-qPCR was performed (Applied Biosystems). Cycle time values were measured as a function of GAPDH mRNA levels in the same lysates.
2.11 Immunofluorescence
The brain sections were permeabilized with 0.4% Triton X-100 for 10 minutes and rinsed three times in PBS solution for 5 minutes each time. After washing, the brain sections were blocked for 35 minutes in 2% bovine serum albumin, and then incubated overnight at 4 °C with primary antibodies: CitH3(1:100, Abcam, ab5103, USA) and MPO (1:50, Abcam, ab90810, USA). Subsequently, the sections were washed with PBS and incubated with appropriate FITC (1:50, Boster, China)-conjugated secondary antibodies for 2 hours at room temperature, followed by counterstain with 4',6'- diamidino-2-phenylindole (DAPI, Invitrogen) for 6 minutes. After the above procedures, the sections were observed and analyzed by ImagePro Plus 6.0.
2.12 Histopathology and Immunohistochemistry
Anesthetized rats were perfused with PBS (0.01 M, pH 7.40, 4 °C) and then perfused with 4% paraformaldehyde (PFA) solution (pH 7.40, 4 °C) transcardially. The brains were dissected in 4% PFA solution for fixation (24 h, 4 °C) and subsequently embedded in paraffin. Sections of 3μm to 5μm thickness were cut and stained with hematoxylin and eosin to observe the brain injury.
Frozen sections were subjected to immunostaining. Briefly, the sections were rehydrated with an ethanol gradient, treated with 0.3% hydrogen peroxide and 0.3% Triton X-100 for 30 minutes, followed by three washes with PBS. The sections were then incubated at 4℃ overnight with anti-β-APP (1:500, Abcam, ab32136, USA), anti-HMGB1(1:50, Zen Bio, 22773, China) or anti-AP1(1:200, CST, 60A8, USA) antibodies diluted in PBS containing 5% normal goat serum. On the second day, the sections were washed three times with PBS and incubated with the appropriate secondary antibodies (1:5000, ThermoFisher Scientific, USA) for 30 minutes at 37℃. After another wash for three times, the sections were incubated with SABC. Subsequently, the samples were washed three times with PBS and reacted with DAB. Finally, all sections were counterstained with hematoxylin for 2 minutes, then dehydrated and coverslipped.
2.13 Statistical Analysis
Results are expressed as mean ± SEM. Data were analyzed using the Mann–Whitney U and two-way ANOVA tests. Values of P <0.05 were considered statistically significant and marked as *P < 0.05, **P < 0.01, ***P < 0.005.