Animals and ethics
Male C57BCLA mice aged 7 weeks (weighing 20 g) were purchased from the Experimental Animal Center of Changhai Hospital Animal Experimental Center. All animal experimental procedures were approved by the Animal Research Ethics Committee of Changhai Hospital and conformed to the Chinese National Institute of Health Guide for the Care and Use of Laboratory Animals.
Induction of colitis and treatment
Acute colitis was induced by administering water supplemented with 3% (wt/vol) DSS to male C57BCLA mice aged 7 weeks. Mice were weighed daily and observed, and the disease activity index (DAI) was evaluated based on weight loss, diarrhea, and bleeding. Mice were sacrificed on day 7, and the colon length was measured. Part of the colon tissue was collected and stored at -80°C for protein and RNA extraction, and another part of the colon tissue was fixed in 4% paraformaldehyde acid and embedded in paraffin for pathological sectioning, hematoxylin and eosin (H&E) staining and immunohistochemistry experiments.
Macrophage generation
The femur was obtained from sacrificed C57BCLA mice, washed with 10% penicillin-streptomycin wash buffer twice, incubated in 75% ethanol for 10 min, and then placed in Dulbecco’s modified Eagle’s medium (DMEM). Next, the bones were cut at each end, the marrow cavity was exposed, and the bone was washed with macrophage cell culture medium (DMEM supplemented with 10% fetal bovine serum (FBS), 30 ng/mL murine macrophage colony-stimulating factor (M-CSF) and 1% penicillin-streptomycin). Then, the bone marrow cells were resuspended and cultured in a 37°C incubator with 5% CO2. Refresh the culture medium every 3 days. Usually, marrow-derived macrophages (BMDMs) mature until day 7.
Cell treatment and Exosome isolation
Usually, marrow-derived macrophages (BMDMs) mature until day 7. The cells were either stimulated with LPS (100 ng/mL, Sigma-Aldrich, St. Louis, MO, USA) or left untreated. The culture medium was changed to exosome-free culture medium, and the cells were harvested after stimulation for 24 h. Exosome isolation was performed with an exosome isolation kit (Invitrogen, USA) following the manufacturer’s instructions.
Exosomes derived from BMDMs were isolated with exosome isolation kits (QIAGEN, USA) according to the manufacturer’s instructions.
Then, total RNA was extracted from BMDM-derived exosomes for small RNA sequencing. Exosomes for in vitro experiments were harvested by differential centrifugation. The detailed steps are listed as follows. FBS free of exosomes was purchased from SBI. BMDMs were cultured in medium with 10% exosome-free FBS. After 24 h, the cell culture medium was collected, and exosomes were isolated from the supernatant by differential centrifugation at 300 ×g for 10 min, 2000 ×g for 15 min, 12,000 ×g for 30 min, and 100,000×g at 4°C for 8 h to remove floating cells and cellular debris and isolate the exosomes.
Exosomal miRNA sequencing
miRNA components in either untreated control macrophage exosomes (n=3) or LPS-induced macrophage exosomes were profiled by small RNA sequencing analysis (Illumina). miRNA-seq reads were quality-assessed with FastQC and MultiQC, trimmed with Trimmomatic 0.30 and subsequently aligned with NovoAlign to all mouse miRNA hairpin sequences in release 21 of miRBase. The resulting alignments were tabulated with a Python script to generate per-miRNA counts.
Establishment of RAW 264.7 macrophage with stably expression relative miRNA
RAW 264.7 macrophages cell line was obtained from the National collection of Authenticated Cell Cultures (Shanghai, China) and cultured in DMEM medium containing 10% FBS, penicillin (100 U/mL) and streptomycin (100 mg/mL), and maintained at 37 °C in a humidified atmosphere of 5% CO2 humidified atmosphere chamber.
Lentivirus purchased from Sunbio (Shanghai, Chian) was used to establish stable miR-223-knockout, overexpression and corresponding negative control (NC) macrophage strains. Cells were divided into 4 groups: 2 group was added with 10 mL cell medium containing knockout and overexpression virus and the other group was added with 10 mL empty vector virus solution. The multiplicity of infection was 15. After 8 h of cell culture, the culture medium was refresh with complete cell medium. After 48h of infection and cell growth, positive clones were screened by using a complete culture medium containing 4.0 mg/mL puromycin for 3 generations. Then the cell with good condition can be consider as stable strain. The supernatants of stable strain expressing miR-223 agomir NC, miR-223 agomir, miR-223 antagomir NC, and miR-223 antagomir were collected to extract exosomes, and the extracted exosomes were injected intraperitoneally. Stable transfection cell lines also seeded in the transwell system, co- culturing with organoids, as described below.
Exosome isolation from macrophage strains and their treatment on mice
The following 6 groups were established to observe the effect of exosomal miR-223 on the progression of IBD: control; DSS, in which mice had access to 3% (wt/vol) DSS; DSS+exosomesmiR-223 agomir-NC, in which mice had access to DSS and were injected with miR-223 agomir NC exosomes; DSS+exosomesmiR-223 agomir, in which mice had access to DSS and were injected with miR-223 agomir exosomes; DSS+exosomesmiR-223 antagomir NC, in which mice had access to DSS and were injected with miR-223 antagomir NC exosomes; and DSS+exosomesmiR-223 antagomir, in which mice had access to DSS and were injected with miR-223 antagomir exosomes. Exosomes from different stable macrophage strains were peritoneal injected to the model mice receiving DSS from day2 to day 7, 108 every day.
Colon organoid culture and treatment
Intestinal tissues from mice and humans were freshly obtained. The tissue was digested with 2 mmol/L EDTA (Gibco, USA) for 30 min and 5 mmol/L EDTA (Gibco, USA) for 30 min twice at 4°C on a roller. The tissue was filtered and 10 mL of 0.1% BSA (Solarbio, China) was added to neutralize the EDTA and obtain the crypts. After isolation, crypt units were plated to a density of 200 crypts per well in a 40-μL droplet of Matrigel mixed with IntestiCult media. Crypt-containing Matrigel droplets were overlaid with IntestiCult complete organoid media (Stemcell Technologies, Vancouver, BC) supplemented with penicillin/streptomycin.
The 4 stable macrophage strains (miR-223 agomir NC, miR-223 agomir, miR-223 antagomir NC, and miR-223 antagomir) mentioned above were plated on up-side of transwell insert membrane for a minimum incubation of 12 h with LPS (100 ng/m) stimulation. After cell attachment rate is about 60%, cocultured with mouse and human organoids in the presence of LPS (100 ng/m, refresh every 24h) to verify the effect of exosomes on the progression of IBD in vitro.
Transcriptome sequencing data and identification of target genes
GSE1543 and GSE16523 (mRNA profiling data sets based on Affymetrix Human Genome U133 Plus 2.0 Array)—consisting of gene expression data of mouse colon tissues from molding until day 7 to remission until day 14—were obtained from the Gene Expression Omnibus (GEO) database. This study extracted the data on days 0, 4, 7, 10 and 14. The raw data of each mRNA were normalized and analyzed by the R package limma and the RobustRankAggreg package. To identify the genes or gene sets coregulated in a time-dependent manner (temporal expression profiles), the software program “Short Time-series Expression Miner” (STEM, version 1.3.11, http:// www.cs.cmu.edu/$jernst/stem/) was used. The main advantage of STEM is that it implements a novel method for clustering short time series expression data, which can distinguish between real and random patterns. To reduce the redundancy, the group was defined as temporal expression profile n (n = 1, 2, 3… n) according to the corresponding P values. Genes belonging to profile n were fellow named temporal expression profile genes n (TEPGs).
Collection and scoring of human samples
Clinical tissue biopsies were collected from the Digestive Endoscopy Center of Changhai Hospital, an open-access academic tertiary endoscopy center. The protocol of this study was carried out according to the principles of the Declaration of Helsinki and approved by the Medical Ethics Committee in Shanghai Changhai Hospital, Shanghai, China. Written informed consent was obtained from all of the participants before enrollment. The severity of disease ranging from a mild/moderate to severe state was evaluated according to the improved Mayo scoring system. The tissue was fixed in 4% (w/v) paraformaldehyde overnight or stored at -80°C for further experiments.
RNA extraction and real-time polymerase chain reaction (RT-PCR)
Total RNA was isolated using TRIzol reagent (Invitrogen, USA) and quantified by measuring the ratio of the absorbance at 260 and 280 nm using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). Then, RNA was converted to complementary DNA (cDNA) using a Thermo Scientific Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) according to the manufacturer’s instructions. Furthermore, reverse transcription PCR was performed using SYBR Green QPCR Master Mix (TaKaRa, Japan). The reaction conditions comprised an initial denaturation at 95°C for 30 s, followed by amplification for 35 cycles at 95°C for 5 s and 60°C for 20 s. The primers were as follows: Claudin l, sense 5’- CCAGGTACGAATTTGGTCAG G -3’ and antisense 5’- TGGTGTTGGGTAAGAGGTTGT -3’; Occludin, sense 5’- CCAGGTACGAATTTGGTCAGG -3’ and antisense 5’- TGGTGTTGGGTAAGAGGTTGT -3’; ZO-1, sense 5’- TCATCCCAAATAAGAACAGAGC -3’ and antisense 5’- GAAGAACAACCCTTTCATAAGC -3’; TNF-α, sense 5’- CAGGCGGTGCCTATGTCTC -3’ and antisense 5’- CGATCACCCCGAAGTTCAGTAG -3’; IL-1β, sense 5’- CGAATGCCACCTTTTTGACAGTG -3’ and antisense 5’- TAGATGCTCTCATCAGGATAG -3’; IL-18, sense 5’- GAAATGCCACCTTTTTGACAGTG -3’ and antisense 5’- CTCCAGCATCAGGACAAAGAAAGCCG -3’; IL-10, sense 5’- GGTTGTCGTCTCATTCTGAAAGA -3’ and antisense 5’- GGTAGAGGACCCAAGTTCGTTAAGA -3’; IL-6, sense 5’- ATGAACTCCTTCTCCACAAGC -3’ and antisense 5’- CTACATTTGCCGAAGAGCCCTCAGGCTGGACTG -3’; and GAPDH, sense 5’- CCATTTGATGTTAGCGGGATCTC -3’ and antisense 5’- TGGTCTACATGTTCCAGTATGACT -3’.
Protein extraction and western blot analysis
Intestinal frozen tissues were thawed at 4°C, and protein was extracted with RIPA buffer (Biyuntian, China) according to the manufacturer’s instructions. Nuclear protein from NCM460 cells was obtained by sonication of nuclear pellets followed by centrifugation. Equal amounts of protein were loaded onto sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gels. After electrophoresis, polyvinylidene fluoride (PVDF) membranes were blocked with 5% nonfat dry milk in TBS-T (20 mM Tris/HCl pH 7.2, 150 mM NaCl, and 0.1% Tween-20) and incubated overnight with different primary antibodies. The dilution concentration was as follows: anti-CD9 (1:500, Abcam, USA), anti-Occludin (1:500, Thermo Scientific, USA), anti-ZO-1 (1:125, Thermo Scientific, USA), anti-E-cadherin (1:1000, Cell Signaling Technology, USA), and anti-TMIGD1 (1:200, Proteintech, China). Next, the membranes were incubated with peroxidase-conjugated anti-mouse IgG (1:2,500; Thermo Scientific, USA) or anti-rabbit IgG (1:5,000; Thermo Scientific, USA) followed by treatment with Super Signal West Pico chemiluminescent substrate (Thermo Scientific, USA). Protein bands were detected by a LAS-3000 image analyzer (Fujifilm, Barcelona, Spain), and the protein levels were quantified by densitometry using Image Gauge Version 4.0 software (Fujifilm). Data were normalized to β-actin.
Electron microscopy
For electron microscopy, exosomes were fixed with 2% paraformaldehyde and loaded on Formvar and carbon-coated copper grids. Then, the grids were placed on 2% gelatin at 37°C for 20 min, rinsed with 0.15 M glycine/PBS, and blocked using 1% cold water fish-skin gelatin. The grids were viewed using a JEOL 1200EX II transmission electron microscope and imaged using a Gatan digital camera.
Exosome tracer experiment
To further explore the effect of exosomes on the intestinal tract, an exosome tracer experiment was performed in this study. Exo-CD63-GFP lentivirus was used to fluorescently label CD63 in macrophages. After constructing a stable cell line, CD63-GFP-labeled exosomes were extracted and added to NCM460 intestinal epithelial cells for observation. The exosome tracer experiment was conducted after the cytoskeleton was labeled with phalloidin.
Flow cytometry
To identify the aforementioned BMDMs and determine their activation level, the cells were harvested and stained with fluorochrome-conjugated antibodies against of the cell-surface antigens F4/80, CD11b and CD68. BMDMs were collected and incubated with F4/80 antibody (1:60, Abcam, USA), CD11b (1:50, BD Biosciences, USA) and CD68 (1:500, BD Biosciences, USA) for 30 min in the dark at room temperature. Then, BMDMs were centrifuged at 1000 rpm for 5 min and washed with 1 mL PBST. Then, the cells were analyzed using fluorescence-activated cell sorting (FACS) (Thermo Fisher Scientific, Waltham, MA, USA). Macrophages are double-positive for CD11b and F4/80, and activated macrophages are positive for CD68.
Transepithelial/trans-endothelial electrical resistance (TEER)
NCM460 cells were seeded (1 × 105 cells/cm2) in a Transwell chamber with 0.4μm pores (Costar, Coring Inc, New York, USA) that had been placed in a 24-well plate. The other Transwell remained blank. After reaching confluence, the cells were differentiated and polarized for 7-10 days in culture medium. TEER was used as a measure of cell monolayer integrity and was assessed before and after all treatments. TEER was measured using an epithelial volt-ohm meter with a chopstick electrode (EMD EVOM2, World Precision Instruments EpithelialVoltohmmete, USA). The electrode was immersed at a 90° angle with one tip in the basolateral chamber and the other in the apical chamber. Care was taken to prevent electrode contact with the monolayer, and triplicate measurements were recorded for each monolayer. An insert without cells was used as a blank, and its mean resistance was subtracted from the resistance of all samples. TEER (Ωcm2) = (Total resistance - Blank resistance) (Ω)* Area (cm2).
Statistical analyses
Data are expressed as the mean ± standard error of the mean (SEM). One-way analysis of variance (ANOVA), followed by Bonferroni’s post-hoc test for repeated measures., was used to analyze the various groups. P < 0.05 was considered statistically significant. All authors had access to the study data and had reviewed and approved the final manuscript.