Generation of mouse monoclonal antibodies specific to mammalian extracellular RON
ExpiCHO cells were used for expression of extracellular human RON protein from amino acids Gly25 to Thr957 fused to an N-terminal His-tag. The expressed protein was purified by Nickel affinity purification using fast purification liquid chromatography (FPLC) and used as an immunogen, following an optimized mouse immunization schedule [12]. Immunized mice were regularly checked for antibody titer against RON immunogen and a chosen mouse was sacrificed for hybridoma fusion. Cell supernatants from fused hybridoma cells were screened in ELISA against the immunogen and control His-tag protein for detection of specific binders.
Immunofluorescence staining of RON binders in live cancer cells expressing endogenous RON
Breast cancer cell line T47D and colorectal cancer cell line HCT116 expressing endogenous RON were seeded in individual wells in a 96 well plate and allowed to adhere overnight. Cell culture supernatants from hybridoma cells were applied as primary antibodies for an hour following fixation by 4% paraformaldehyde. IgGs were detected with Alexa Fluor 488 conjugated anti-mouse IgG. Cells were counterstained with DAPI and viewed with the Incell Analyzer (GE Healthcare).
Western blot analysis of RON antibody clones in cell lysates expressing endogenous and transfected RON
Cells were harvested and lysed by sonication in 0.1% Triton X PBS supplemented with protease inhibitor cocktail (Roche). The QuickStart Bradford protein assay (BioRad) was used to determine protein concentration. BSA was used as a protein standard. 20 µg of cell lysates were mixed with NuPAGE lithium dodecyl sulphate (LDS) and sample reducing buffer (Thermo Scientific), heated for 5 min at 95 °C and loaded into 4-12% Mini-PROTEAN precast gels (Biorad) for electrophoresis. Separated cell lysates were transferred onto nitrocellulose membranes using the Trans-Blot turbo transfer system device (Biorad). Blocking was performed with 5% milk or bovine serum albumin (BSA) in PBS supplemented with 0.1% tween (TBST). Hybridoma supernatants were applied to individual cell lysate strips as primary antibody and detected with goat anti-mouse IgG (H+L) (Jackson Laboratories). The enhanced chemiluminescence (ECL) reagent used was SuperSignal West Dura Extended Duration Substrate (Thermo Scientific, #34076). Imaging and acquisition were performed with Licor Odyssey Fc and Image Studio (Li-Cor Biosciences).
Generation of RON knockout cell lines in HCT116, HT29 and T47D by CRISPR Cas9
HCT116, HT29 and T47D cells were chosen for knockout of RONMST1R by CRISPR. A guide RNA containing the spacer (GGCGGGAGGAGCTCCATCG) that directs Cas9 to cut at the ATG initiation codon of MST1R was cloned into pX458, a plasmid, which contains the gRNA scaffold, spCas9-3xNLS and an EGFP reporter. This plasmid was transfected into HT29 and T47D cells using Lipofectamine 3000, and EGFP-positive cells were selected by FACS. Single clones were isolated and screened for MST1R knockout by directed Sanger sequencing near the Cas9 cut site with the following primers (Forward: ggtccgctatcttggggc; Reverse: ctgggcaccacgtacttcac).
Immunoprecipitation of RON with RON antibodies
1X107 cells were harvested from T47D wildtype and T47D RON KO cell lines using RIPA buffer. 10 µg/ml of purified antibodies were added to 200 µg of cell lysate and allowed to bind overnight at 4 °C in individual tubes. Antibody-RON complexes were picked up using Protein G Dynabeads magnetic beads (Thermo Scientific) and eluted in 20mM Tris-Glycine pH2.7 buffer. The eluted proteins were detected in western blotting using hydrogen peroxidase enzyme conjugated in-house anti-alpha RON antibody 6E6. SuperSignal West Dura Extended Duration Substrate (Thermo Scientific) was used for detection of chemiluminescence signal. Imaging and acquisition were performed using Licor Odyssey Fc and Image Studio (version 3.1).
Flow cytometry analysis of RON antibodies with fixed and live cancer cells
1X106 cells were harvested from T47D wildtype and T47D RON KO cell lines and washed in PBS. Cells were blocked and either paraformaldehyde fixed or stained live. Primary antibody staining was performed using 10 µg/ml of purified anti-RON antibodies. Cells were subsequently incubated with goat anti-mouse FITC-conjugated secondary antibodies (Invitrogen). FACS analysis was performed using FACS LSRII machine (Becton Dickinson). FlowJo (Tree Star Inc. USA) software was used for data analysis.
Binding affinity studies of RON antibodies using Kinetic Exclusion Assay
Mammalian produced recombinant extracellular His-tag RON protein was used for affinity measurements. Affinity determinations were carried out in the fixed antigen format. Antibodies were titrated as two-fold dilutions into a fixed concentration of RON antigen. RON protein was detected using mouse monoclonal to 6xHis-Tag (Dylight@650, Thermo Fisher). All affinity measurements were carried out using the KinExa 4000 (Sapidyne Instruments).
Study of downstream RON antibodies signaling using phosphorylation assays
60000 T47D cells and T47D RON-/- cells were seeded into individual wells in a 96 well plate. Varying concentrations of antibodies, wortmannin or control mouse sera were added to individual wells for an hour before addition of MSP (10nM) for half an hour. Experiments were run in triplicate. The cells were harvested for p-ERK level analyses using the AlphaLISA SureFire Ultra p-ERK1/2 (Thr202/Tyr204) Assay Kit (Perkin Elmer) as per manufacturer’s protocol.
Antibody dependent cellular cytotoxicity assay on RON antibodies
All antibodies used for the antibody dependent cellular cytotoxicity assay were carried out with engineered chimeric RON antibodies which retained the mouse Fabs with a human Fc backbone and expressed recombinantly. Blood was collected from individuals that provided consent and all protocols were approved by the institutional review board (IRB). NK cells were isolated using the EasySep™ Direct Human NK Isolation Kit (Stemcell Technologies). The effector to target ratio used was 10:1 based on target T47D cells initial seeding. ADCC activities were measured using the xCelligence platform (Roche Applied Science) using plates with detector electrodes that quantify the number of cells attached to the bottom of the wells, reflected by a calculated cell index (CI). The CI was measured every 15 minutes over 72 hours after the antibody treatment. Treatments were performed in triplicates, with averages and standard deviations calculated by the instrument.
In vivo animal imaging studies on 3F8 and 10G1
In vivo xenograft model
Female nu/nu Balb/c mice (n = 8) were housed under standard laboratory conditions and fed ad libitum. All experiments complied with Swedish law and were performed with permission from the Uppsala Committee of Animal Research Ethics. Tumor xenografts were formed by subcutaneous inoculation of approximately 1 x 106 RON-positive HT29 cells on the right posterior leg and 1 x 106 RON null HCT116 cells on the left posterior leg.
DFO-conjugation and 89ZrRadiolabeling of 10G1 and 3F8
Conjugation of p-SCN-Bn-Deferoxamine (DFO) to Ab’s and 89Zr-labelling was performed as described previously [13]. In brief, Ab’s (2mg/ml dissolved in 0.07 M borax buffer, pH 9.4) were incubated with the bifunctional chelator DFO (B-705, Macrocyclics Dallas, TX, USA) in the molar ratio of 1:3 (antibody to DFO) for 1 h at 37°C using a thermomixer at 350 rpm. Unbound-DFO and Ab-DFO were separated with a NAP-5 column equilibrated with 0.25M ammonium acetate (pH 5.4–5.6).
20MBq 89Zr-oxalic (solid target production, clinical grade; kindly provided by Dr. Thuy Tran, KI, Stockholm) acid solution was added to 400µg Ab at pH 6.8-7.2 (0.1 M Na2CO3 and 0.5 M HEPES were added for pH adjustment) and incubated for 1 h at room temperature while gently shaking at 350 rpm. Radiolabeling efficiency and radionuclidic purity (typically > 96%) was determined by chromatography strips (ITLC) using 0.2 M citric acid (pH 4.9-5.1) as mobile phase and analysis using a Fujifilm Bas-1800II phosphorimager (Fuji, Tokyo, Japan).
In vitro radioimmunoassay
1 nM of 89Zr-10G1 or 89Zr-3F8 was added to approximately 0.5*106 HT29 (RON +) or HCT116 (RON KO) cells, and incubated at 37°C, 5% CO2. After 24 h, cells were washed, trypsinized and counted. Cell-associated radioactivity was measured in a gamma counter (1480 Wizard 3”, Wallace, Turku, Finland). Radioactivity count was adjusted for cell number, and the signal on HT29 cells was normalized to HCT116 signal using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA). Statistical analysis of differences in uptake between antigen-positive and antigen-negative cells was performed using Graph Pad Prism 8, using unpaired student's t-test, with p<0.05 (*), p<0.01 (**), and p<0.001 (***).
PET imaging of 89Zr-10G1 and 89Zr-3F8
Xenografted mice were injected via the tail vein with 50µg of 89Zr-10G1 (n=4) or 89Zr-3F8 (n=4) antibodies (injected activity 1.1 and 0.8 MBq), respectively. Whole-body PET/MRI/CT studies were performed under general anesthesia (sevoflurane 2.0-3.5% in 50% / 50% medical oxygen + air at 60 ml/ min) after 24 h, 48 h and 72 p.i. (i.v.) for 89Zr-10G1 (n=2) and 89Zr-3F8 (n=2). Pre-injected mice were placed under sedation in the gantry of a small-animal nanoScan PET/MR scanner (Mediso Medical Imaging Systems Ltd., Hungary) and a whole-body PET scan was performed for 60 min in list mode followed by a CT scan in nanoScan SPECT/CT scanner (Mediso Medical Imaging Systems Ltd., Hungary) for 5 min. The breathing rate was monitored and animals were placed on the heated bed to prevent hypothermia. PET data was reconstructed into a static image and corrected for the time of injection using the Tera-Tomo ™ 3D reconstruction (6 subsets and 4 iterations). The raw CT data was reconstructed using filtered back projection. PET and CT Dicom files were analyzed with PMOD v3.510 (PMOD Technologies Ltd, Zurich, Switzerland).
Biodistribution of 89Zr-10G1 and 89Zr-3F8
Biodistribution of RON antibodies in xenografts was studied 72 hours p.i. following PET analyses for 89Zr-10G1 (n=4) and 89Zr-3F8 (n=4). Animals were euthanized with a mixture of ketamine and xylazine followed by heart puncture. Blood was collected, HCT116 tumors, thyroid (en bloc with larynx), heart, liver, kidneys, spleen, urinary bladder, colon, upper gastrointestinal tract, skin, bone and muscle were excised, weighed and measured in a gamma well-counter (1480 Wizard; Wallace Oy, Turku, Finland). Injection standards were measured for each time point. Radioactivity uptake in the organ was calculated as the percentage of injected dose per gram of tissue (%ID/g). Thyroid uptake was calculated as the percentage of injected dose per organ (%ID/organ).
Statistical analysis of differences in uptake between antigen-positive and antigen-negative tumors was performed with Graph Pad Prism 8 (GraphPad Software, San Diego, USA), using unpaired student's t-test, with p<0.05 (*), p<0.01 (**), p<0.001 (***) and p<0.0001 (****).