Cell lines
NPC cells, including CNE-1, CNE-2, SUNE-1 and 5-8F, were cultured in RPMI medium 1640 (NCS, Hyclone, Invitrogen) supplemented with 10%FBS (Gibco BRL, Grand Island, NY, USA). The immortalized normal nasopharyngeal epithelial cell line (NP69) was cultured in Keratinocyte-SFM medium supplemented with epidermal growth factor (Invitrogen, Carlsbad, NM, USA). All cells were maintained at 37°C under 5% CO2.
shRNA and lentiviruses
Short hairpin RNA targeting CENPU (shCENPU-1 and shCENPU-2) and a scrambled control shRNA (shCtrl) were synthesized by Shang-hai Genechem. NPC cells were infected with shRNA-encoding lentiviruses, and CNE-2 cells were chosen for further experiments in vitro and in vivo.
Quantitative real-time PCR
Total RNA was extracted using TRIzol (Invitrogen, USA). To measure CENPU mRNA expression, complementary DNA (cDNA) was synthesized Using Transcriptor cDNA Synth Kit (Roche, USA). Real-time PCR was performed using the FastStart Universal SYBR Green Mast (Roche, USA). The primer sequences were: CENPU forward 5’ -ATGAACTGCTTCGGTTAGAGC-3’ and reverse 5’- TATTTCGCAGATGGCTTTCGG-3’. The primer sequences were: DUSP6 forward 5’ - GAACTGTGGTGTCTTGGTACATT -3’ and reverse 5’-GAACTGTGGTGTCTTGGTACATT-3’. GAPDH was used to normalize the expression of mRNA. The fold changes were calculated using relative quantification method (2−ΔΔCt). All reactions were performed in triplicate times.
Cell growth and Clone formation assay
Celigo (Nexcelom), a cell count instrument, was used to detect cell growth. 2000 cell/well were seeded and each group has 3 multiple holes. From the second day after laying, the Celigo reading board is tested once a day for 5 days continuously. By adjusting the input parameters of analysis settings, the number of cells with green fluorescence in each scanning orifice plate was accurately calculated and then cell proliferation curve for 5 days was drawn.
Migration and invasion assays
For migration and invasion assays, CNE-2 cells in serum-free medium were added to the upper chamber of 8.0μm pore size (Corning, USA) without or with Matrigel (BD Biosciences, USA), and 20% FBS was added to the lower chamber. After 24h (migration assays) or 48h (invasion assays), cells in the lower chamber were fixed, stained, and photographed.
Western blotting analyses and Immunohistochemistry (IHC)
Western blotting was performed using standard protocols. Primary antibodies, including rabbit anti-CENPU polyclonal antibody (1:2000; ImmunoWay Biotechnology Company, USA), rabbit anti-p-NF-κB monoclonal antibody (1:1000; Cell Signaling Technology, USA), rabbit anti-Erk1/2 monoclonal antibody (1:1000; Cell Signaling Technology, USA), rabbit anti-p-Erk1/2 monoclonal antibody (1:1000; Cell Signaling Technology, USA). Rabbit anti-GAPDH polyclonal antibody (1:10000; Abcam, USA) was used as a loading control. IHC staining was performed according to standard protocols. Paraffin slices were incubated with primary antibodies against CENPU (1:400; ImmunoWay Biotechnology Company, USA). The scores of CENPU were determined by multiplying the intensity score and percentage score to figure out a semiquantitative H-score. The mean H-score from all patients was used as the cutoff value to define CENPU positivity, which was described in our previous article[20].
Xenograft growth and lung metastasis model
For the xenograft growth model, CNE-2 cells were subcutaneously injected into nude mouse with a concentration of 2×107 cells. Tumor volume and average of total fluorescence expression were measured and compared. For the lung metastasis model, CNE-2 cells were intravenously injected through the tail vein with a concentration of 1.0 × 106 cells. Fluorescent imaging and total radiant efficiency were taken and compared. Number of metastatic nodes in lung were sampled and quantified after the mice were sacrificed. The xenograft model in our study is in accordance with ARRIVE guidelines (https://arriveguidelines.org).
GeneChip
GeneChip primeview human was performed to identified differentially expressed genes (DEG) between knock down groups and normal control groups (NC). KD refers to the downregulation of CENPU in CNE-2 cells, then stably transfected cells were selected, and NC refers to the transfection of control into CNE-2 cells. Then, linear model analysis based on empirical Bayesian distribution to calculate the significant difference level (p-value), and Benjamini-Hochberg method was used to correct the false discovery rate (FDR). Genes with p value ≤ 0.05 and fold change (FC) > 2.0 were considered significant. Hierarchical Clustering and Volcano Plot of the significant genes were plotted using R programming language. Then, Ingenuity Pathway Analysis was used to perform classical pathway analysis, biological downstream effect analysis, disease and functional analysis, regulatory effect analysis and interaction network analysis according to the DEGs.
Ingenuity Pathway Analysis
Ingenuity pathways analysis (Ingenuity Systems, Mountain View, CA) is a robust and expertly curated database containing up-to-date information on over 20,000 mammalian genes and proteins, 1.4 million biological interactions, and 100 canonical pathways incorporating over 6,000 discreet gene concepts. This information is integrated with other relevant databases such as Entrez- Gene and Gene Ontology. The experimental data sets were used to query the IPA and to compose a set of interactive networks taking into consideration canonical pathways, the relevant biological interactions, and the cellular and disease processes.
Co-immunoprecipitation experiments
Co-immunoprecipitation (Co-IP) experiments were conducted using a PierceTM Co-IP kit (Thermo Scientific) and performed according to the protocol. Briefly, cell lysates were incubated with antibodies against CENPU (Abcam, USA) or DUSP6 (Abcam, USA) in 4 ℃ overnight. After incubation, the antigen/antibody complex was combined with magnetic beads for 1 hour at room temperature. Then, magnetic beads were washed twice using immunoprecipitation lysis and washed once using pure water. Then, protein was eluted using elution buffer. IgG (Santa Cruz Biotechnology) was used as a negative control. Lastly, samples were resolved by SDS-PAGE and analyzed by western blot.
Statistical analysis
All statistical analyses were performed using the software SPSS version 24.0 (SPSS, Chicago, USA) and Graph Pad Prism 8 (GraphPad Prism, USA). P value less than 0.05 was considered statistically significant.