Role of the ClC-2 Chloride Channel in TGF-β1-induced Proliferation, Collagen Synthesis, and Collagen Gel Contraction Mediated by Human Conjunctival Fibroblasts

doi:10.21203/rs.2.20695/v1

Download PDF

Research article

Role of the ClC-2 Chloride Channel in TGF-β1-induced Proliferation, Collagen Synthesis, and Collagen Gel Contraction Mediated by Human Conjunctival Fibroblasts

https://doi.org/10.21203/rs.2.20695/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Excessive scar tissue can reduce postoperative survival of filtering blebs in patients with glaucoma. Previous studies have highlighted the role of chloride channels in wound healing. whereas The role of chloride channels in the formation of follicular scar has not been studied.

Objectives: To investigate the effects of the ClC-2 chloride channel on scar formation of filtering blebs after glaucoma filtering surgery.

Methods: We Inhibited ClC-2 chloride channels of Human Conjunctival Fibroblasts (HConFs) by transfecting HConFs with ClC-2 siRNA, Then cell proliferation, cycle and collagen synthesis of HConFs were measured. ClC-2 siRNA-transfected HConFs were cultured in type I collagen gels in the presence of transforming growth factor (TGF)-β1. Collagen gel contraction was evaluated based on the gel area. The expression levels of matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in HConFs were assessed by western blotting and q-PCR.

Results: TGF-β1induced cell proliferation, cell cycle progression, collagen synthesis, and collagen gel contraction in HConFs. TGF-β1 increased MMP-2 and MMP-9 levels but inhibited the expression of TIMPs. ClC-2 siRNA transfection inhibited TGF-β1-induced cell proliferation, cell cycle progression, collagen synthesis, and collagen gel contraction, mediated by HConFs. TGF-β1-induced increases in MMP-2 and MMP-9 were also inhibited by NPPB and ClC-2 siRNA transfection, but TIMP expression was increased by ClC-2 siRNA transfection.

Conclusions: These findings demonstrate that ClC-2 gene knockout inhibited TGF-β1-induced cell proliferation, collagen synthesis, and collagen gel contraction of HConFs by attenuating MMP-2 and MMP-9 production and by stimulating TIMP-1 production.

Keywords: ClC-2 chloride channel; conjunctival fibroblasts; TGF-β1; wound heal

Ophthalmology

ClC-2 chloride channe

conjunctival fibroblasts

TGF-β1

wound heal

Excessive filtering bleb scar formation after glaucoma filtration surgery is the most frequent cause of surgical failure. Human conjunctival fibroblasts (HConFs) are key cells involved in the subconjunctival wound healing response, which involves the activation, proliferation, and migration of local fibroblasts as well as the synthesis of extracellular matrix components and its subsequent contraction[1, 2]. Excessive deposition of matrix components and contraction of the subconjunctival tissue at the wound site, resulting in destruction of the normal tissue architecture, determine scar formation and surgery failure

TGF-β is secreted during the early stages of scar formation by inflammatory cells and acts as a chemoattractant to promote fibroblast transformation to myofibroblasts, which synthesize extracellular matrix[3, 4]. Accumulation of ECM structural proteins increases bleb capsule fibrosis. Matrix metalloproteinases (MMPs) constitute a large family of enzymes that remodel ECM by degrading ECM molecules during the wound-healing process. The action of MMPs is regulated by a group of endogenous tissue inhibitors of metalloproteinases (TIMPs)[5]. Imbalance between MMPs and TIMPs may lead to excessive degradation or increased accumulation of the ECM, resulting in excessive wound healing.

Chloride channels (ClCs) are a type of permeable channel protein for chloride ions or other anions on the cell membrane, and ClC proteins are encoded by genes of the ClC family[6]. ClC-2 is a member of the ClC voltage-gated chloride channel superfamily and is ubiquitously expressed in organs act as an regulator of cell volume and control the response to swelling and post-synaptic responses to GABA and glycine [7, 8]. In the prevention of hyperplasia and remodeling of cerebrovascular smooth muscle cells ClC-2 plays an important role by inhibiting cell proliferation and migration [9]. ClC-2 also modulates wound epithelialization by regulating the migratory ability of rat keratinocytes [10]. In this study, the effects of the ClC-2 chloride channel on cell proliferation, collagen synthesis, collagen contraction, and MMP and TIMP production by HConFs were evaluated.

Cell Culture

HConFs were obtained from ScienCell Research Laboratories (San Diego, CA, USA), where they were isolated from human conjunctiva. HConFs were characterized by their spindle morphology and immunoreactivity with antibodies to fibronectin. Cells were grown at 37 °C in a humidified incubator with 5% CO₂ in fibroblast medium (ScienCell Research Laboratories) containing 2% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, and fibroblast growth supplement (undisclosed formulation).

Transfection of HConFs with siRNA

To knockdown ClC-2 expression, we obtained commercially available stealth siRNA duplex oligoribonucleotides targeting the human ClC-2 gene. The sequence was 5′-UCCUCAUGAGGAAACGCCUGCUCUU-3′, and its corresponding complementary strand was 5′-AAGAGCAGGCGUUUCCUCAUGAGGA-3′. The negative control consisted of a non-silencing scrambled sequence that did not recognize any known sequence available in the GenBank. To examine the uptake of ClC-2 siRNA by HConFs, siRNA was labeled with Alexa Fluor 488 (Invitrogen Life Technologies, Inc., Carlsbad, CA, USA) for determination of siRNA transfection efficiency. HConFs were transfected with oligonucleotides in the presence of Lipofectamine 2000 (Invitrogen Life Technologies, Inc.) in Opti-MEMI (Invitrogen Life Technologies, Inc.) for 4 h at 37 °C. After removing the transfection mixture, the cells were further incubated for 24 h before experiments under normal growth conditions. The expression of ClC-2 was detected by western blotting and RT-qPCR analysis.

Cell Proliferation Assay (CCK-8 Assay)

HConFs were plated at a density of 5,000 cells/well in a 96-well plate. After treatment, 10 µL of CCK-8 solution (BestBio, Jiangsu, China) was added to each well, followed by incubation for another 3 h at 37 °C. Absorbance at 450 nm was measured using an automated microplate reader (Model 3001 − 1387; Thermo Fisher, Waltham, MA, USA). Each group was provided with 6 duplicate holes, and the experiment was repeated 3 times.

Cell Cycle Analysis

Cell cycle status was assessed by flow cytometry using a Cell Cycle and Apoptosis Analysis Kit (Beyotime, Jiangsu, China). Briefly, cells were grown in 100-mm plates with 10% FBS for 24 h. After treating the cells with media containing different reagents for 48 h, they were collected and fixed in 75% ethanol for 24 h at 4 °C. After rinsing cells with PBS, the cells were stained with PI buffer (containing 500 µL staining buffer, 25 µL of 20 × propidium iodide, and 10 µL of 50 × RNase). The cell cycle distribution was assessed by flow cytometry (CYTOMICS FV 500, Beckman Coulter, Brea, CA, USA).

Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA was extracted from HConFs at 60–80% confluency with RNAiso Plus (Takara Bio Inc., Shiga, Japan), and 500 ng RNAwas used to synthesize single-stranded cDNA with the RT for PCR Kit (Takara Bio Inc.). Quantitative real-time PCR was performed using methods similar to those previously described[11]. Oligonucleotide primers for the collagen III, MMP2, MMP9, TIMP1, and GAPDH genes were designed using the Primer3 program (http://frodo.wi.mit.edu/primer3/), and sequences are listed in Table 1.

Table 1

Oligonucleotide primers for genes in quantitative real-time RT-PCR
Human genes	Sequences	Product size (kb)
collagen III	Forward: (5′–3′) TCAGGGTGTCAAGGGTGAA	130
	Reverse:(5′–3′) AGGGTTTCCATCTCTTCCA
MMP2	Forward: (5′–3′) TATGGCTTCTGCCCTGAGAC	142
	Reverse:(5′–3′) CACACCACATCTTTCCGTCA
MMP9	Forward: (5′–3′) AGTCCACCCTTGTGCTCTTC	117
	Reverse:(5′–3′) ACTCTCCACGCATCTCTGC
TIMP1	Forward: (5′–3′) CTGTTGTTGCTGTGGCTGAT	130
	Reverse:(5′–3′) TCTGGTTGACTTCTGGTGTCC
GAPDH	Forward: (5′–3′) CAGGAGGCATTGCTGATGAT	126
	Reverse:(5′–3′) CAGGAGGCATTGCTGATGAT

Western Blotting Analysis

HConFs were washed with pre-cooled PBS three times and lysed with RIPA buffer [50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM PMSF]. The total protein was quantified with the Enhanced BCA Protein Assay Kit (Beyotime). Protein (20 µg per sample) was separated by SDS-PAGE and transferred to PVDF membranes, which were then blocked with blocking solution for 1 h at 37 °C. The membranes were incubated with rabbit polyclonal anti-ClC-2 (Abcam), mouse monoclonal anti-collagen I (Abcam), mouse monoclonal anti-collagen III (Abcam), rabbit polyclonal anti-MMP2 (Abcam), rabbit polyclonal anti-MMP9 (Abcam), rabbit polyclonal anti-TIMP1 (Abcam), and/or mouse monoclonal anti-β-actin (Beyotime) antibodies overnight at 4 °C. Following two washes with TBST, the membrane was incubated with horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody (Beyotime) or anti-mouse IgG secondary antibody (Beyotime) for 1 h at room temperature. Final detection was accomplished with enhanced chemiluminescence western blotting reagents (Beyotime). Band density was analyzed using ImageJ (NIH, Bethesda, MD, USA).

Assay of Collagen Gel Contraction

The collagen gel contraction assay was performed according to previously described methods [9], with some modifications. HConFs were harvested by treatment with trypsin-EDTA, washed twice with serum-free MEM, and resuspended in the same medium. Briefly, collagen I (from a rat tail) stock solution (5 mg/mL) (Solarbio, Beijing, China), 0.1 M NaOH, 10 × concentrated PBS, and the cell suspension were mixed on ice at a volume ratio of 200:12:23:765 (final concentration of type I collagen, 1 mg/mL; final cell density, 2 × 10⁵/mL). A portion (0.5 mL) of the mixture was added to each well of the 24-well culture plate and allowed to solidify by incubation at 37 °C under 5% CO₂ for 20 min. The collagen gels were freed from the sides of the wells using a 10-µL tip, and serum-free MEM (0.5 mL) containing TGF-β1 (10 ng/mL) was then added to the top of each gel. The gel area was examined at 48 h using ImageJ. For normalization, the area of the collagen gel containing untreated HConFs was set to 100%, and the fold changes in the area for each treatment group were determined. Four gels were assayed for each experimental condition, and all experiments were repeated four times.

Data Analyses

Results are expressed as means ± standard error (number of observations), and differences among groups were evaluated using analysis of variance (ANOVA). Statistical significance was defined as p < 0.05. All experiments were repeated four times.

Effect of ClC-2 Chloride channel on TGF-β1-Induced HConF proliferation

As shown in Fig. 1, TGF-β1 (10 ng/mL) increased HConF proliferation by 28.66% (p < 0.05 vs. control) after 48 h of stimulation. HConF transfected with ClC-2 siRNA in the presence of TGF-β1 showed a 39.20% reduction in cell viability compared to that of TGF-β1-treated negative siRNA control cells. Non-transfected and mutant siRNA-transfected cells had similar viabilities. These results demonstrate that knockout of ClC-2 inhibits TGF-β1-induced HConF cell proliferation.

Effect of ClC-2 Chloride channel on TGF-β1-Induced HConF cell cycle

There were statistically significant differences in the proportion of cells in each cell cycle among the four groups(G0/G1 phase:F = 237.08, P = 0.00; S phase:F = 11.07, P = 0.00; G2/M phase: F = 228.09, P = 0.00 ). Compared with the control group, the proportion of cells in G1 phase was significantly reduced in the TGF- β1 treatment group, while the proportion of cells in S phase and G2/M phase was increased, with statistically significant differences TGF-β1 promoted cell cycle progression by advancing cells from the G0/G1 to S and G2/M phases, but knockout of ClC-2 inhibited TGF-β1-induced cell cycle progression by arresting cells in the G0/G1 phases (Fig. 2, Table 2).

Table 2

Cell cycle distribution of HconF in each group(mean ± SD, %)
Group	Sample size	Cell distribution in different cell cycle
Group	Sample size	G0/G1 phase	S phase		G2/M phase
Control	4	64.43 ± 3.71		8.37 ± 3.02		27.20 ± 1.92
TGF-β1	4	54.60 ± 2.19		10.40 ± 2.19		35.00 ± 2.56
TGF-β1 + siRNA-NC	4	52.40 ± 3.14		10.31 ± 3.02		37.32 ± 3.23
TGF-β1 + siRNA-CLC-2	4	71.80 ± 3.16		8.51 ± 3.12		19.70 ± 3.18
F value P value		237.08		11.07		228.09
F value P value		0.00		0.00		0.00

Effect of ClC-2 Chloride channel on TGF-β1-Induced Collagen Gel Contraction Mediated by HConFs

As shown in Fig. 3, exposure to TGF-β1 stimulated HConF-mediated collagen contraction of the free-floating three-dimensional collagen gel and resulted in a significant reduction in the gel area as compared to that of controls (p < 0.01). The gel area of TGF-β1 + ClC-2 siRNA group was reduced compared with the TGF-β1 group and TGF-β1-treated negative siRNA control group, The TGF-β1-induced contraction of HConF cells was inhibited by the siRNA-mediated downregulation of ClC-2.

Effect of ClC-2 Chloride channel on TGF-β1-Induced Collagen Synthesis

TGF-β1 induced high levels of collagen III expression at the protein and mRNA levels in HConFs compared to levels in control cells. The knockout of ClC-2 significantly inhibited the TGF-β1-induced expression of collagen III. The expression levels of collagen III were similar in TGF-β1-treated non-transfected cells and TGF-β1-treated negative siRNA control cells. (Fig. 4)

Effect of ClC-2 Chloride channel on TGF-β1-Induced MMP/TIMP Expression

TGF-β1 increased the protein and mRNA expression levels of MMP-2 and MMP-9, which negatively regulate collagen synthesis and deposition. TGF-β1 resulted in lower expression of TIMP1, a positive regulator that promotes collagen expression, at the protein and mRNA levels in HConFs than in control cells. Levels of MMP-2 and MMP-9 were lower in the ClC-2 siRNA-transfected group than in the non-transfected and mutant siRNA-transfected groups in the presence of TGF-β1. Conversely, the expression of TIMP1 was higher in the ClC-2 siRNA-transfected group than in the non-transfected and mutant siRNA-transfected groups in the presence of TGF-β1 (Fig. 5,6).

In the present study, we induced a series of conjunctival scarring responses with TGF-β1. Subsequently, the effects of ClC-2 chloride channel on HConF scarring responses were measured. We found that ClC-2 siRNA transfection inhibited TGF-β1-induced HConF proliferation, collagen synthesis, and collagen gel contraction. Exaggerated wound contraction induced by elevated TGF-β levels has become a therapeutic target in fibrosis [12]. A study by Arslan et al. [13] showed that filtration surgeries increased TGF-β expression. Similar to our results, Liu et al. [14] found that TGF-β-induced collagen gel contraction was mediated by human Tenon fibroblasts.

Chloride channels are expressed in nearly all eukaryotic cells and play an important role in cell proliferation, apoptosis, and migration [15]. The regulatory effect of ClC chloride channels on cell proliferation has been shown in many studies[16]. A study by Warsi et al. [17] showed that downregulation of the chloride channel ClC-2 by Janus kinase 3 influenced cell proliferation and apoptosis. In osteosarcoma cells, ClC-3 silencing inhibited cell proliferation and migration via the AKT/GSK3β signaling pathway [18]. Li et al. [19] found that overexpression of the chloride intracellular channel 5 (CLIC5) inhibited proliferation of C2C12 cells and drove more C2C12 cells into the G0/G1 phase. We previously blocked the chloride channel of ARPE19 in human adult RPE cells using NPPB and tamoxifen (TAM) and found that this inhibited proliferation by arresting cells in the G0/G1 phase[20]. ClC-2, a ubiquitously expressed member of the superfamily of ClC transporters and channels, has been confirmed to be expressed in human conjunctival fibroblasts [11]. Our result showed that ClC-2 siRNA transfection inhibited TGF-β1-induced HConF cell proliferation by arresting cells in the G0/G1 phase.

Recent studies have highlighted the role of chloride channels in wound healing. Fuchigami et al. [21] showed that the chloride channel blocker NPPB reduced epidermal wound closure by blocking the CIC-3 chloride channel. Further, local enhancement of CIC-3 expression at the leading edge of the wounded epidermis was specific to closing wounds, suggesting that the intracellular translocation of CIC-3 was involved in wound closure. Schiller et al. [22] found that CFTR chloride channels positively regulated wound healing in cell culture models of the airway surface epithelium. Thus, inhibition of conjunctival fibroblast proliferation is the main strategy for treatment of anti-glaucoma filtration scarring.

Cell-mediated tissue contraction is a complex process that involves various cellular activities, including cell migration and reorganization of the ECM, and MMPs have been implicated in wound contraction and matrix reorganization [23]. Collagen contraction involves the cell-directed reorganization of collagen fibrils and plays a significant role in wound healing. In the present study, a three-dimensional model of wound healing that closely mimics the in vivo situation was established. We found that TGF-β1 promoted HConF collagen synthesis and collagen gel contraction. ClC-2 gene knockout inhibited TGF-β1-induced HConF collagen synthesis and collagen gel contraction. Multiple studies have shown that chloride channels are involved in collagen synthesis [24–26]. Qi et al. [24] showed that the chloride channel blocker DIDS inhibited the collagen release of HFL1 fibroblasts. Downregulation of CLIC4 also reduced TGF-β1-induced expression of ECM components in primary fibroblasts [25]. In the development of atrial fibrillation, CLIC 1, 4, and 5 played an important role by interacting with collagen IV[26, 27].

Inhibition of MMPs has been shown to limit subconjunctival scarring after experimental glaucoma filtration surgery in rabbits [27]. The balance between MMPs and TIMPs in the ECM is important for regulation of the ECM and wound healing [23]. The ratio of MMPs to TIMPs is an important factor in various biological activities, including cell migration, angiogenesis, and remodeling of the ECM [28]. Du and Yang [21] found that ClC-3 knockout attenuated osteosarcoma cell migration via downregulation of MMP-2 and MMP-9. In the present study, TGF-β1 induced expression of MMP-2 and MMP-9 but inhibited TIMP-1 expression in HConFs. TGF-β1-induced expression of MMP-2 and MMP-9 was inhibited by ClC-2 siRNA transfection in HConFs. ClC-2 siRNA transfection increased TIMP-1 expression in the presence of TGF-β1.

Consistent with our results, Guan et al. [29] found that MMP-1, MMP-2, and MMP-3 levels were increased by TGF-β1, while TGF-β1 inhibited TIMP-1 expression. They also found knockdown of ClC-3 expression inhibited MMP-9 expression in ectopic endometrial cells. Wang et al.[30] silenced the ClC-3 gene and found that MMP-3 and MMP-9 levels were reduced. Our results showed that the ClC-2 knockout decreased TGF-β1-induced proliferation, collagen synthesis, and contractility of HConFs cultured in a three-dimensional collagen gel, in part by blocking MMP production. Further in vivo studies are needed to confirm the preventive effect of ClC-2 chloride channels on filtering bleb scarring after filtration surgery.

These findings demonstrate that knockdown of ClC-2 expression inhibited TGF-β1-induced cell proliferation, collagen synthesis, and collagen gel contraction of HConFs by attenuating MMP-2 and MMP-9 production and by stimulating TIMP-1 production. ClC-2 chloride channels may therefore prove to be a new control target to inhibit scar formation of filtering blebs.

HConFs

Human Conjunctival Fibroblasts

MMPs

matrix metalloproteinases

TIMPs

metalloproteinases

ClCs

Chloride channels

Ethics approval and consent to participate

This article has been reviewed and approved by the ethical committee of Yanbian University Affiliated Hospita.

Consents to publish

Not applicable

Availability of data and material

The datasets used during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This work was supported by the National Natural Science Foundation of China project (grant number: 81760171) and Jilin Eeducation Department Project (grant number: JJKH20191117KJ). The role of the funding was in buy reagents and supplies for the experiment, collecting the data and writing the manuscript.

Authors' contributions

Lixia Sun writed the article; Renzhe Cui and Huan Meng guided the experiment; Xin Liu and Xiwen Liu conducted the experiment; Kun Liu and Liang Jia analysised the data; Yan Lu and Yonghu Chi revised the article; Yajuan Zheng designed the work. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Merkel PA, Silliman NP, Clements PJ, Denton CP, Furst DE, Mayes MD, et al. Patterns and predictors of change in outcome measures in clinical trials in scleroderma: an individual patient meta-analysis of 629 subjects with diffuse cutaneous systemic sclerosis. Arthritis Rheum. 2012 Oct;64(10):3420-9. PubMed PMID: 22328195. Pubmed Central PMCID: 3357459.
Hoogewerf CJ, van Baar ME, Middelkoop E, van Loey NE. Patient reported facial scar assessment: directions for the professional. Burns. 2014 Mar;40(2):347-53. PubMed PMID: 24138808.
Chen N, Guo D, Guo Y, Sun Y, Bi H, Ma X. Paclitaxel inhibits cell proliferation and collagen lattice contraction via TGF-beta signaling pathway in human tenon's fibroblasts in vitro. Eur J Pharmacol. 2016 Apr 15;777:33-40. PubMed PMID: 26930229.
Meyer-Ter-Vehn T, Grehn F, Schlunck G. Localization of TGF-beta type II receptor and ED-A fibronectin in normal conjunctiva and failed filtering blebs. Mol Vis. 2008 Jan 25;14:136-41. PubMed PMID: 18334936. Pubmed Central PMCID: 2255025.
Valimaki J, Uusitalo H. Matrix metalloproteinases (MMP-1, MMP-2, MMP-3 and MMP-9, and TIMP-1, TIMP-2 and TIMP-3) and markers for vascularization in functioning and non-functioning bleb capsules of glaucoma drainage implants. Acta Ophthalmol. 2015 Aug;93(5):450-6. PubMed PMID: 25588965.
Strange K. Of mice and worms: novel insights into ClC-2 anion channel physiology. News in physiological sciences : an international journal of physiology produced jointly by the International Union of Physiological Sciences and the American Physiological Society. 2002 Feb;17:11-6. PubMed PMID: 11821530.
Grunder S, Thiemann A, Pusch M, Jentsch TJ. Regions involved in the opening of CIC-2 chloride channel by voltage and cell volume. Nature. 1992 Dec 24-31;360(6406):759-62. PubMed PMID: 1334533.
Bosl MR, Stein V, Hubner C, Zdebik AA, Jordt SE, Mukhopadhyay AK, et al. Male germ cells and photoreceptors, both dependent on close cell-cell interactions, degenerate upon ClC-2 Cl(-) channel disruption. EMBO J. 2001 Mar 15;20(6):1289-99. PubMed PMID: 11250895. Pubmed Central PMCID: 145530.
Lu J, Xu F, Zhang Y, Lu H, Zhang J. ClC-2 knockdown prevents cerebrovascular remodeling via inhibition of the Wnt/beta-catenin signaling pathway. Cell Mol Biol Lett. 2018;23:29. PubMed PMID: 29988306. Pubmed Central PMCID: 6022329.
Pan F, Guo R, Cheng W, Chai L, Wang W, Cao C, et al. High glucose inhibits ClC-2 chloride channels and attenuates cell migration of rat keratinocytes. Drug Des Devel Ther. 2015;9:4779-91. PubMed PMID: 26355894. Pubmed Central PMCID: 4560522.
Sun L, Dong Y, Zhao J, Yin Y, Zheng Y. The CLC-2 Chloride Channel Modulates ECM Synthesis, Differentiation, and Migration of Human Conjunctival Fibroblasts via the PI3K/Akt Signaling Pathway. International journal of molecular sciences. 2016 Jun 9;17(6). PubMed PMID: 27294913. Pubmed Central PMCID: 4926444.
12. Kasuya A, Tokura Y. Attempts to accelerate wound healing. J Dermatol Sci. 2014 Dec;76(3):169-72. PubMed PMID: 25468357.
13. Arslan S, Aydemir O, Guler M, Dagli AF. Modulation of postoperative scarring with tacrolimus and octreotide in experimental glaucoma filtration surgery. Curr Eye Res. 2012 Mar;37(3):228-33. PubMed PMID: 22335810.
14. Liu Y, Kimura K, Orita T, Teranishi S, Suzuki K, Sonoda KH. Inhibition by all-trans-retinoic acid of transforming growth factor-beta-induced collagen gel contraction mediated by human tenon fibroblasts. Invest Ophthalmol Vis Sci. 2014 Jun 3;55(7):4199-205. PubMed PMID: 24894398.
15. Okada Y, Maeno E. Apoptosis, cell volume regulation and volume-regulatory chloride channels. Comp Biochem Physiol A Mol Integr Physiol. 2001 Oct;130(3):377-83. PubMed PMID: 11913451.
16. Zhou FM, Huang YY, Tian T, Li XY, Tang YB. Knockdown of Chloride Channel-3 Inhibits Breast Cancer Growth In Vitro and In Vivo. J Breast Cancer. 2018 Jun;21(2):103-11. PubMed PMID: 29963105. Pubmed Central PMCID: 6015970.
17. Warsi J, Elvira B, Hosseinzadeh Z, Shumilina E, Lang F. Downregulation of chloride channel ClC-2 by Janus kinase 3. J Membr Biol. 2014 May;247(5):387-93. PubMed PMID: 24615260.
18. Du S, Yang L. ClC-3 chloride channel modulates the proliferation and migration of osteosarcoma cells via AKT/GSK3beta signaling pathway. Int J Clin Exp Pathol. 2015;8(2):1622-30. PubMed PMID: 25973047. Pubmed Central PMCID: 4396317.
19. Li F, Yin J, Yue T, Liu L, Zhang H. The CLIC5 (chloride intracellular channel 5) involved in C2C12 myoblasts proliferation and differentiation. Cell Biol Int. 2010 Mar 8;34(4):379-84. PubMed PMID: 20055760.
20. Zhao J, Zhong W, Sun L, Yin Y, Zheng Y. Effect of chloride channel activity on retinal pigment cell proliferation and migration. Mol Med Rep. 2017 Apr;15(4):1771-6. PubMed PMID: 28259964.
Fuchigami T, Matsuzaki T, Ihara S. Possible roles of ENaC and Cl(-) channel in wound closure in Xenopus laevis embryos. Zoolog Sci. 2011 Oct;28(10):703-11. PubMed PMID: 21967216.
Schiller KR, Maniak PJ, O'Grady SM. Cystic fibrosis transmembrane conductance regulator is involved in airway epithelial wound repair. Am J Physiol Cell Physiol. 2010 Nov;299(5):C912-21. PubMed PMID: 20686068. Pubmed Central PMCID: 2980302.
Ito T, Ohguro H, Mamiya K, Ohguro I, Nakazawa M. Effects of antiglaucoma drops on MMP and TIMP balance in conjunctival and subconjunctival tissue. Invest Ophthalmol Vis Sci. 2006 Mar;47(3):823-30. PubMed PMID: 16505013.
Qi S, den Hartog GJ, Bast A. Superoxide radicals increase transforming growth factor-beta1 and collagen release from human lung fibroblasts via cellular influx through chloride channels. Toxicol Appl Pharmacol. 2009 May 15;237(1):111-8. PubMed PMID: 19268487.
Shukla A, Edwards R, Yang Y, Hahn A, Folkers K, Ding J, et al. CLIC4 regulates TGF-beta-dependent myofibroblast differentiation to produce a cancer stroma. Oncogene. 2014 Feb 13;33(7):842-50. PubMed PMID: 23416981. Pubmed Central PMCID: 3912213.
Jiang YY, Hou HT, Yang Q, Liu XC, He GW. Chloride Channels are Involved in the Development of Atrial Fibrillation - A Transcriptomic and proteomic Study. Sci Rep. 2017 Aug 31;7(1):10215. PubMed PMID: 28860555. Pubmed Central PMCID: 5579191.
Fingleton B. Matrix metalloproteinases as regulators of inflammatory processes. Biochimica et biophysica acta Molecular cell research. 2017 Nov;1864(11 Pt A):2036-42. PubMed PMID: 28502592.
Wong TT, Mead AL, Khaw PT. Matrix metalloproteinase inhibition modulates postoperative scarring after experimental glaucoma filtration surgery. Invest Ophthalmol Vis Sci. 2003 Mar;44(3):1097-103. PubMed PMID: 12601035.
Guan YY, Wang GL, Zhou JG. The ClC-3 Cl- channel in cell volume regulation, proliferation and apoptosis in vascular smooth muscle cells. Trends Pharmacol Sci. 2006 Jun;27(6):290-6. PubMed PMID: 16697056.
Wang B, Xie J, He HY, Huang EW, Cao QH, Luo L, et al. Suppression of CLC-3 chloride channel reduces the aggressiveness of glioma through inhibiting nuclear factor-kappaB pathway. Oncotarget. 2017 Sep 8;8(38):63788-98. PubMed PMID: 28969029. Pubmed Central PMCID: 5609961.

Download PDF

Version 1

posted

You are reading this latest preprint version

Role of the ClC-2 Chloride Channel in TGF-β1-induced Proliferation, Collagen Synthesis, and Collagen Gel Contraction Mediated by Human Conjunctival Fibroblasts

Status:

Version 1

Abstract

Figures

Background:

Materials and Methods

Results

Discussion

Conclusions:

Abbreviations

Declarations

References

Status:

Version 1