Cells, viruses, reagents and antibodies
Porcine kidney (PK15) cells were purchased from ATCC (Manassas, VA, USA) and cultured in antibiotic-free DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) at 37°C in a humidified atmosphere containing 5% CO2. The PEDV strain JS-2/2014 was isolated from a piglet with watery diarrhea and stored in our laboratory. The BVDV-2 strain SH-28 was kindly provided by Prof. Guoqiang Zhu of Yang Zhou University. The NF-κB inhibitor (BAY11-7082) was purchased from Selleck (Houston, TX, USA). Antibodies against IκBα, p-IκBα, GAPDH and β-actin were purchased from Cell Signaling Technology (Danvers, MA, USA). Polyclonal antibody against BVDV E2 protein was purchased from Bioss Biotechnology (Beijing, China). The monoclonal antibody directed against the PEDV N protein was purchased from BioNote (Hwaseong-si, South Korea).
Infection and coinfection of PK15 cells by PEDV and BVDV
PK15 cells were cultured in 6-well dishes to approximately 80% confluence. Then, the cells were monoinfected with PEDV strain JS-2/2014 or BVDV-2 strain SH-28 or coinfected with both strains at a multiplicity of infection (MOI) of 0.01 and incubated in serum-free DMEM containing 2 µg/mL trypsin (Promega, Madison, WI, USA). Uninfected cells served as the mock-infected group. Viral propagation was confirmed by indirect immunofluorescence assay (IFA) and western blot assay.
IFA for the detection of PEDV and BVDV coinfection in PK15 cells
PK15 cells grown on a 6-well plate were infected with PEDV or BVDV or coinfected with both at 0.01 MOI. At 6, 12, and 24 hours post infection (h.p.i.), the cells were fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100 for 10 min, and incubated in blocking buffer. IFA was then performed by staining with a monoclonal antibody against PEDV N protein and a polyclonal antibody against BVDV E2 protein. After gentle washing, the cells were incubated with FITC-conjugated donkey anti-mouse IgG and Alexa Fluor 546-conjugated donkey anti-rabbit IgG (Thermo Fisher Scientific, Waltham, MA, USA) as secondary antibodies. The cell nuclei were stained with 4′,6′-diamidino-2-phenylindole (DAPI) (Beyotime Biotechnology, Shanghai, China). The cells were visualized under a florescence microscope (Carl Ziess, Oberkochen, Germany).
Titer determination of virus stocks
PK15 cells grown on 35-mm dishes were infected with PEDV or BVDV or coinfected with both at 0.01 MOI. After 1 h, the medium was replaced with fresh DMEM containing 2 µg/mL trypsin. Cultured samples were collected at 24, 48, 72, and 96 h.p.i. for TCID50 determination by IFA. The IFA protocol was as described above. Virus titers were determined by viewing the infected cells under a fluorescence microscope and calculated on the basis of the Reed-Muench method.
Western blot assay
The infected cells were harvested at the indicated time points and lysed in RIPA buffer (Beyotime). Equal amounts of total proteins were separated on SDS-PAGE gels. After electrophoresis, proteins were transferred onto nitrocellulose filter membranes (Millipore, Billerica, MA) and stained with primary antibodies overnight at 4°C, followed by HRP-conjugated secondary antibodies at room temperature for 1 h. The protein bands were detected using enhanced chemiluminescence detection kits (Thermo Fisher Scientific, Waltham, MA, USA).
Sample preparation for proteomics, protein isolation, labeling with TMT reagents, and LC–MS/MS analysis
PK15 cells were monoinfected with PEDV strain JS-2/2014 or BVDV strain SH-28 or coinfected with both at an MOI of 1. At 24 h.p.i., cells from all experimental groups were collected, washed three times with ice-cold PBS, and lysed with 1 mL lysis buffer (8 M urea, 50 mM Tris-HCl, 0.2% SDS, pH 8.5) followed by ultrasonication on ice for 5 min. The lysate was centrifuged at 12,000 × g for 10 min to remove the insoluble debris. The supernatant was collected and reduced with 2 mM DTT at 56°C for 1 h and subsequently alkylated with sufficient iodoacetamide for 1 h. The extracted proteins were precipitated with precooled acetone, washed twice, and redissolved in buffer containing 0.1 M TEAB and 8 M urea (pH 8.5). The protein concentration was quantified by the Bradford protein assay. A total of 100 µg protein from each sample was digested with Trypsin Gold (Promega). After trypsin digestion, peptides were desalted using a C18 cartridge to remove urea and dried by vacuum centrifugation. For TMT labeling, the peptides were processed using 6-plex TMT reagents according to the protocol (Thermo Fisher Scientific). The labeled peptides were fractionated using a C18 column on a Rigol L3000 HPLC. The samples were then dried using a vacuum and reconstituted in 0.1% (v/v) formic acid (FA) in water for subsequent LC–MS/MS analysis. This analysis was performed by Novogene Bioinformatics Technology Co., Ltd.
Proteomics Data Normalization and Analysis
Spectral data were processed using Proteome Discoverer 2.2 with the MASCOT engine (version 2.2; Matrix Science, London, UK) against the UniProt database (Sus_scrofa_uniprot_2020_1_8.fasta), containing 120594 sequences. The mass error was set to 10 ppm for precursor ions and to 0.02 Da for fragment ions, and a maximum of 2 miscleavage sites were allowed. For protein quantitation, proteins were required to contain at least 1 unique peptide and a false discovery rate (FDR) of no more than 1.0%. Statistical analyses of data among groups were performed using Student's t-test. For accurate comparisons between samples, proteins with fold changes ≥1.2 or ≤0.83 and a P-value <0.05 were considered as DEPs.
Bioinformatic analysis
Functional classification of DEPs was performed based on Gene Ontology (GO) enrichment analysis (http://www.geneontology.org/). Pathway enrichment analysis of DEPs was carried out using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (http://www.genome.jp/kegg/). Enriched KEGG pathways with Bonferroni adjusted P value (q value) <0.05 were considered significant by using the hypergeometric test.
Relative quantitative PCR (qPCR)
Total RNA was extracted from infected and uninfected cells at the indicated times using TRIzol reagent (Thermo Fisher Scientific). cDNA synthesis was performed using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China) according to the manufacturer’s protocol. qPCR was carried out using SYBR Premix Ex Taq II (TaKaRa Bio, Shiga, Japan) with an ABI 7500 sequence detection system (ABI, Madison, USA). The amplification conditions consisted of 95°C for 30 s and 40 cycles of 95°C for 5 s, 60°C for 30 s, and 95°C for 15 s. The β-actin gene was used as an internal standard, and the relative expression levels of each gene in the samples were calculated using the 2−ΔΔCt method[16]. The primer sequences used for amplifications were as follows: IL-6 (F: ATTCGGTACATCCTC GACGGC, R: CAGCCATCTTTGGAAGGTTCAGGT), IL-8 (F: TTTCAGAGACAGCAGAGCACA, R: CACACAGAGCTGCAGAAATCAG), IL-18 (F: GAATCTAAATTATCAGTCATAAG, R: GATAGATCTATAATGTTCACTG), TNF-α (F: CTCAGCAAGGACAGCAGAGG, R: ATGTGGCGTCTGAGGGTTGTT), β-actin (F: TGGGTCAGAAGGACTCCTATG, R: CAGGCAGCTCATAGCTCTTCT).
Luciferase reporter gene assays
PK15 cells were cultured in 24-well plates and cotransfected with 100 ng of the luciferase reporter pNF-κB-luc and 10 ng of the constitutive Renilla luciferase reporter pRL-TK (Promega). After transfection for 24 h, the cells were infected with PEDV or BVDV or coinfected with both at an MOI of 1. Then, 24 h later, the cells were lysed and subjected to luciferase assays using the Dual Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocol. The results are shown as the means ± SD of triplicate wells and expressed as relative luminescence units (RLUs).
Drug treatment
Drug experiment was conducted to inhibit NF-κB pathway. PK15 cells were treated with 1 μM Bay11-7082 or DMSO as control, and monoinfected with PEDV strain JS-2/2014 or BVDV strain SH-28 or coinfected with both at an MOI of 1. At 1 h of virus infection, cells were washed, and the medium was replaced with maintenance medium containing Bay11-7082 at 1 μM. Then, 24 h later, cells were subjected to qPCR analyses of the inflammatory cytokine expressions.