The effect of nicotinamide adenine dinucleotide phosphate oxidase 4 on migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis

doi:10.21203/rs.2.20756/v2

Download PDF

Research article

The effect of nicotinamide adenine dinucleotide phosphate oxidase 4 on migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis

https://doi.org/10.21203/rs.2.20756/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 15 May, 2020

Read the published version in Arthritis Research & Therapy →

You are reading this older preprint version

Read the latest preprint version →

Background: Reactive oxygen species (ROS) regulate the migration and invasion of fibroblast-like synoviocytes (FLS), which are key effector cells in rheumatoid arthritis (RA) pathogenesis. Nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4) induces ROS generation and consequently, enhances cell migration. Despite the important interrelationship between RA, FLS, and ROS, the effect of NOX4 on RA pathogenesis remains unclear. Methods: FLS isolated from RA (n=5) and osteoarthritis (OA, n=5) patients were stimulated with recombinant interleukin 17 (IL-17; 10 ng/ml) and tumor necrosis factor alpha (TNF-α; 10 ng/ml) for 1 h. Cell migration, invasion, adhesion molecule expression, vascular endothelial growth factor (VEGF) secretion, and ROS expression were examined. The mRNA and protein levels of NOX4 were analyzed by RT-qPCR and western blotting, respectively. The NOX4 inhibitor GLX351322 and NOX4 siRNA were used to inhibit NOX4 to probe the effect of NOX4 on these cellular processes. Results: Migration of RA FLS was increased 2.48-fold after stimulation with IL-17 and TNF-α, while no difference was observed for OA FLS. ROS expression increased in parallel with invasiveness of FLS following cytokine stimulation. When the expression of NOX was examined, NOX4 was significantly increased by 9.73-fold in RA FLS compared to unstimulated FLS. Following NOX4 inhibition, cytokine-induced vascular cell adhesion molecule 1 (VCAM1), VEGF, and migration and invasion capacity of RA FLS were markedly decreased to unstimulated levels. Conclusion: NOX4 is a key contributor to cytokine-enhanced migration and invasion via modulation of ROS, VCAM1, and VEGF in RA FLS.

Rheumatology

Internal Medicine

Rheumatoid arthritis

Osteoarthritis

Fibroblast-like synoviocytes

Reactive oxygen species

NADPH

NOX4

VCAM1

VEGF

Rheumatoid arthritis (RA) is a systemic autoimmune disease that is characterized by joint inflammation and bone destruction [1, 2]. During RA pathogenesis, there is excessive immune cell infiltration into synovial joints, stimulating other immune cells, endothelial cells, and fibroblast-like synoviocytes (FLS) [3]. Activated FLS can cause synovial hyperplasia in the joint, attach to and invade the cartilage surface, cause destruction of the cartilage and bone, and activate immune responses [4]. Although migration and invasion of FLS play important roles in the initiation and development of RA, these processes are induced by diverse factors through complex pathways [5].

Reactive oxygen species (ROS), which are more abundant in RA patients than in controls, are considered to be a significant contributor to RA pathogenesis [6, 7]. ROS act as signaling molecules to modulate cell migration, proliferation, survival, and homeostasis [8]. Although a certain amount of ROS is essential for cell protection, excessive oxidative stress contributes to inflammation, cancer, aging, and autoimmune diseases. Most intracellular ROS are generated from mitochondria and catalyzed by the enzyme complex nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) [9, 10]. There are seven of NOX proteins: NOX1-5 and DUOX1-2. Notably, NOX4 induces ROS generation and cell migration in human lung endothelial cells [11]. Recently published data suggest that the proangiogenic factor leptin triggers the migration and invasion of RA FLS via elevated ROS generation [12]; however, the specific mechanism of NOX4 in FLS invasion remains to be fully characterized in RA.

In this study, we induced pro-inflammatory conditions in FLS using recombinant interleukin 17 (IL-17) and tumor necrosis factor alpha (TNF-α) treatment, as these cytokines are critical in RA pathogenesis rather than OA [13, 14]. The pro-inflammatory cytokine IL-17 is highly expressed in RA synovium and directly stimulates FLS activation [15] while TNF-α inhibition is an effective universal therapy option for RA treatment. Because active migratory phenotype and strong cartilage invasiveness are unique characters of RA FLS [16], OA FLS were used as control. Actually, the primary faulty of OA is caused by cartilage rather than synovium in clinical outcome [17]. OA FLS have been widely used for comparison with RA FLS. Here, we investigated the effects of IL-17 and TNF-α on migration and invasion of FLS isolated from patients with RA and OA and further explored the effects of NOX4 inhibition in the pathogenesis of RA.

Human subjects and ethics statement

Synovial tissues were obtained from 5 female RA patients (average age 61.6 ± 1.67 y) and 5 female OA patients (average age 64.8 ± 16.10 y) who were undergoing synovectomy or joint replacement. The diagnosis of RA conformed to the College of Rheumatology (ACR)/European League Against Rheumatism (EULAR) 2010 classification criteria [18]. After removing fat and fibrous tissues, the synovium was cut into small pieces and incubated with 0.1% collagenase (Sigma-Aldrich) in Dulbecco’s modified Eagle’s medium (DMEM) at 37°C for 3 h. Cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS, Gibco) and maintained in a 5% CO₂ incubator at 37°C. FLS were used for experiments after four to six passages. This study was performed according to the recommendations of the Declaration of Helsinki and approved by the Institutional Review Board of Chungnam National University Hospital (CNUH 2015-10-052).

Transwell migration and Matrigel invasion assay

FLS were cultured in serum-free media for 5 h. Following pre-incubation with or without NOX4 inhibitor (GLX351322, MedKoo Biosciences) for 1 h, RA FLS were stimulated with recombinant IL-17 (10 ng/ml, Peprotech) and TNF-α (10 ng/ml, Peprotech) for 1 h. For the transwell migration assay, cells were centrifuged and loaded onto transwell filters with an 8-μm pore (Corning) positioned on top of the migration chamber for 23 h. DMEM containing 10% FBS was transferred to the bottom chamber of the transwell plate as a chemoattractant. For the invasion assay, transwell filters were pre-incubated with Matrigel (Corning) at 37°C for 1 h. Then, transwells were incubated at 37°C for 3 d, fixed with 100% methanol, and stained with crystal violet (Sigma-Aldrich). Non-migrating cells on the top membrane surface were removed by washing with PBS and cotton swabs. Invaded cells were counted in five random fields per sample under an inverted microscope (magnification, x100; 0.55 numerical aperture dry objective; Scale bar, 100 µm; Olympus). For quantification, the crystal violet dye was eluted with 0.1% sodium dodecyl sulfate (SDS) and quantitated using a Sunrise absorbance reader (Tecan) at 595 nm.

Wound migration assay

When FLS cultures were approximately 90% confluent, cells were incubated with serum-free media for 5 h. FLS monolayers were wounded with pipette tips and treated with recombinant IL-17 and TNF-α for 1 h. Wound closure was monitored and photographed at 0 and 24 h with a Olympus inverted microscope (magnification, x100; 0.55 numerical aperture dry objective; Scale bar, 100 µm). To quantify the migrated cells, pictures of the initial wounded monolayers were compared with the corresponding pictures of cells at the end of the incubation.

Flow cytometric analysis

FLS cultures were incubated with serum-free media for 5 h and then stimulated with recombinant IL-17 and TNF-α for 1 h. Culture media was changed, and the cells were incubated with FITC-conjugated anti-human vascular cell adhesion protein 1 (VCAM1; BD Biosciences), PE-Cy™5-conjugated anti-human intercellular adhesion molecule 1 (ICAM1; BD Biosciences), and PE-Cy™7-conjugated anti-human neural cell adhesion molecule 1 (NCAM1; BD Biosciences). To detect ROS levels, cells were stained with MitoSOX™ Red mitochondrial superoxide indicator (Invitrogen) according to the manufacturer’s instructions. Cells were analyzed with a FACSCantoⅡ flow cytometer (BD Biosciences), and data were processed with FlowJo software (Tree Star).

Enzyme-linked immunosorbent assay (ELISA)

VEGF concentrations were measured using ELISA kits for human VEGF (R&D Systems) according to the manufacturers’ instructions. VEGF levels were estimated by interpolation from a standard curve generated using a Sunrise absorbance reader (Tecan) at 450 nm.

Real-time PCR and RT-PCR

Total RNA was extracted using TRI Reagent (Molecular Research Center), according to the manufacturer’s instructions. Extracted RNA was used in reverse transcription reactions with ReverTra Ace® qPCR RT Master Mix (TOYOBO) according to the manufacturer’s instructions. SYBR® Green Realtime PCR Master Mix (TOYOBO) was used for real-time PCR analysis of cDNA according to the manufacturer’s instructions. The primers were synthesized by Bioneer (see Table 1 for primer sequences). Thermal cycling conditions were as follows: initial denaturation at 95°C for 5 min, 40 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 20 s. A melting step was performed by raising the temperature from 72°C to 95°C after the last cycle. Thermal cycling was conducted on a CFX Connect Real-Time PCR Detection System machine (Bio-Rad Laboratories). The target gene expression levels are shown as a ratio in comparison with the levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in in the same sample via calculation of the cycle threshold (Ct) value. The relative expression levels of target genes were calculated by the 2^-ΔΔCT relative quantiﬁcation method.

For RT-PCR, the synthesized cDNA was mixed with AccuPower® RT PreMix (Bioneer) and 10 pmol of each specific PCR primer following the manufacturer’s protocol. Amplified products were separated on 1% agarose gels, stained with Midori green advance (NIPPON Genetics), and photographed under UV illumination using a GelDoc system (Bio-Rad Laboratories).

Western blot analysis

Cells were ruptured on ice using a RIPA lysis kit (ATTO Corporation), lysates were clarified by centrifugation, and samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred onto polyvinylidine (PVDF) membranes (Bio-Rad), which were then incubated with antibodies against NOX4 (1/1000 dilution; Abcam) and β-actin (1/2000 dilution; Sigma-Aldrich) overnight at 4°C. After washing with PBS-T, membranes were stained with peroxidase-conjugated goat anti-rabbit IgG (Abcam) or peroxidase-conjugated rabbit anti-mouse IgG (Abcam). Target proteins were then detected using the chemiluminescent HRP Substrate (Thermo Fisher Scientific).

siRNA transfection

Specific siRNA targeting NOX4 was purchased from Santa Cruz Biotechnology (sc-41586). Cells were transfected with lipofectamine transfection reagent (Invitrogen) and the indicated siRNA duplex targeting constructs. After incubation for 24 h, downregulation of target expression was evaluated by RT-PCR and western blot analysis.

Statistical analysis

Statistical analysis was performed using the paired Student’s t-test in SPSS 18.0. P-values <0.05 were considered statistically significant.

Increased migration and invasion in RA FLS

Migration of activated FLS mediates bone damage in RA progression via invasion through the cartilage [19]. We therefore investigated whether RA FLS have increased cell migration in response to stimulation with IL-17 and TNF-α. Following treatment with IL-17 and TNF-α for 1 h, migration of FLS from patients with RA and OA was examined using a transwell chamber assay. Cell migration was increased by 2.48-fold in RA FLS stimulated with cytokines compared to those without stimulation (2.48 ± 0.50), while cell migration did not differ for OA FLS in response to cytokine stimulation (1.01 ± 0.18; Figure 1A-B). This differential migration in response to IL-17 and TNF-α was confirmed using a scratch assay in which cell movement into the wounded area was markedly increased in RA compared to OA cultures (Figure 1C). When cell invasion was analyzed using a Matrigel-coated transwell membrane, IL-17 and TNF-α stimulation significantly enhanced the invasion ability of RA FLS compared to unstimulated RA FLS controls (2.92 ± 0.67, Figure 1D). Invasion by OA FLS was not changed following cytokine treatment (1.14 ± 0.12). These data indicate that RA FLS have increased cell migration and invasion in response to IL-17 and TNF-α stimulation than OA FLS.

Higher cytokine-induced expression of VCAM1, VEGF, and ROS in RA FLS than in OA FLS

The joint angiogenic process is mediated by various factors, such as cell adhesion molecules, cytokines/chemokines, and proteases [20]. Adhesion molecules, such as VCAM1, play a critical role in FLS migration and mediate joint inflammation and destruction [21]. We thus determined whether IL-17 and TNF-α promote increased expression of adhesion molecules in RA and OA FLS. Cells were incubated with IL-17 and TNF-α for 1 h, and surface expression of VCAM1, ICAM1, and NCAM1 were analyzed after 23 h. VCAM1, ICAM1, and NCAM1 were increased by nearly 3-fold in OA FLS following cytokine exposure, while expression of these adhesion molecules in RA FLS was significantly increased by 5- to 8-fold following cytokine stimulation (Figure 2A). The angiogenic growth factor VEGF was also examined in FLS following exposure to IL-17 and TNF-α. Under basal conditions, VEGF exhibited a 3-fold increase in RA FLS compared to OA FLS; however, cytokine stimulation upregulated VEGF similarly in both RA and OA FLS (Figure 2B).

Overexpression of NOX4 by IL-17 and TNF-α in RA FLS

ROS generation is closely regulated by the NOX assembly system [23]. To determine whether NOX is involved in the differential expression of ROS in RA and OA, FLS were treated with IL-17 and TNF-α for 1 h and analyzed by real time PCR for NOX family gene expression. Among NOX isoforms, NOX4, and NOX2 expression was significantly enhanced in RA FLS (Figure 3A). Expression of the NOX2/4-binding proteins, p22phox and p67phox, was also highly upregulated in RA FLS following IL-17 and TNF-α treatment (Figure 3B). The increased mRNA expression of NOX4 peaked 1 h after cytokine stimulation in RA FLS (Figure 3C). Following incubation of RA FLS with IL-17 and TNF-α, NOX4 protein levels were markedly elevated for 6h up to 24 h compared to unstimulated control FLS (Figure 3D). These data showed that NOX4 may be a major contributor to the enhanced ROS-mediated migration and invasion of FLS in RA.

Decreased migration and invasion by NOX4 inhibition

We next wanted to determine whether NOX4 is a critical regulator in IL-17 and TNF-α-induced migration and invasion in RA. RA FLS were incubated with increasing doses of the NOX4-specific inhibitor GLX351322 for 1 h, and then cells were treated with IL-17 and TNF-α for 1 h. After 23 h, the cytokine-induced ROS levels were substantially reduced by the NOX4 inhibitor in a dose-dependent manner (Figure 4A-B). Among the cytokine-induced adhesion molecules, only VCAM1 was distinctly decreased following NOX4 inhibition (Figure 4C). Cell migration and VEGF secretion were also significantly reduced by NOX4 inhibition in RA FLS (Figure 5A-B). When FLS were treated with NOX4-specific inhibitor alone, cell functions didn’t affected (data not shown).

To confirm the role of NOX4 in cell invasion, we reduced the mRNA levels of NOX4 in RA FLS using siRNA transfection (Figure 5C). After verification of NOX4 silencing, RA FLS were incubated with IL-17 and TNF-α for 1 h, and cell invasion was assessed using a Matrigel-coated transwell chamber assay. When RA FLS were transfected with control siRNA, IL-17 and TNF-α markedly enhanced the invasion capabilities of RA FLS; however, NOX4 knockdown suppressed the invasive ability of stimulated FLS compared with those treated with control siRNA (Figure 5D-E). Despite IL-17 and TNF-α treatment, FLS invasion was inhibited compared to untreated controls in NOX4-silenced RA FLS. These findings demonstrate that cytokine-induced migration and invasion are dependent on a NOX4-VCAM1-VEGF pathway.

FLS are the major population in the synovium and play a critical role in arthritis pathogenesis. In this study, we investigated the effects of the arthritis-associated cytokines IL-17 and TNF-α on the migration and invasion of FLS. IL-17 and TNF-α are the primary focus in RA disease research, and combined blockade of both cytokines has been suggested as a novel therapy for patients who are unresponsive to selective TNF-α inhibition [24, 25]. Here, we revealed that NOX4 mediated a differential response to IL-17 and TNF-α stimulation in RA FLS compared to OA FLS. Specifically, NOX4 was increased by cytokine exposure and was required for RA FLS migration and invasion via increased expression of VCAM1 and VEGF. Our findings therefore highlight NOX4 as a potential treatment target in RA.

Interestingly, while RA FLS demonstrated a rapid and robust increase in migration and invasion following cytokine stimulation, FLS from OA donors showed little or no enhancement. The differential responses may be related to the different amounts of IL-17 and TNF-α in synovium. Indeed, IL-17 was detected at higher concentrations in RA synovium than in OA or control synovium [26, 27]. Although migration and invasion in OA FLS did not change with cytokine stimulation for 1 h, expression of VCAM1, ICAM1, NCAM1, and VEGF was increased 2-3-fold. Therefore, we concluded that the adhesion molecules and angiogenic factors were differentially regulated by these cytokines through a mechanism that is distinct from cell migration and invasion.

Next, we investigated whether IL-17 and TNF-α affected ROS levels in RA and OA FLS, because ROS have been shown to directly induce cell migration and invasion in the context of cancer [28]. Mitochondria-specific ROS expression was increased by cytokines in RA FLS but not OA FLS, and similar results were found for invasiveness. Our findings strongly suggest that IL-17 and TNF-α induce a differential increase in ROS that leads to the distinct invasion capabilities between RA and OA.

The increased intracellular ROS in FLS may negatively influence RA-associated synovium changes, such as immune cell activation and pro-inflammatory cytokine secretion, as well as invasion of FLS into bone [29, 30]. In relation to cell migration, ROS-generating enzymes in the NOX family have been suggested as therapeutic target molecules in various diseases, such as cardiovascular disease, autoimmune disease, and inflammation [31, 32]. It was shown that RA FLS exhibited aggressive features, such as hypoxia, invasion, and inflammation, which are similar to cancer [33]. NOX4 overexpression in human colorectal cancer was associated with poor prognosis and increased tumor migration and invasion [34]. In vascular inflammatory disease, NOX4 knockdown mediated a significant decrease in inflammation [35, 36]. Although inhibition of excessive ROS has previously been suggested as an important target in RA treatment, few studies have investigated the role of NOX and RA FLS.

When mRNA expression in RA FLS was analyzed in response to IL-17 and TNF-α stimulation, NOX4 was increased most among the NOX family members. Following NOX4 inhibition in RA FLS, cytokine-induced ROS, VCAM1, VEGF, migration, and invasion were downregulated to levels observed for untreated controls. Together, these results indicate that IL-17- and TNF-α-mediated NOX4 expression activates a ROS-VCAM1-VEGF pathway that contributes to FLS migration and invasion in RA.

One limitation of this study is the use of ex vivo human FLS, which may not precisely reflect the in vivo response. Further study using an animal RA model is needed. In addition, the mRNA expression of NOX2 was also significantly increased in RA FLS, and therefore additional study of the role of NOX2 in RA is warranted.

In conclusion, we revealed that NOX4 was upregulated in RA FLS following IL-17 and TNF-α stimulation, leading to aggressive migration and invasion via a ROS-VCAM1-VEGF pathway. These findings suggest that NOX4 may be a critical factor in RA pathogenesis and that this enzyme may provide a therapeutic target for treatment of RA and other inflammatory diseases.

We investigated the effects of IL-17 and TNF-a on migration and invasion of FLS isolated from patients with RA and OA and further explored the effects of NOX4 inhibition in the pathogenesis of RA. Here, we revealed that NOX4 mediated a differential response to IL-17 and TNF-α stimulation in RA FLS compared to OA FLS. Specifically, NOX4 was increased by cytokine exposure and was required for RA FLS migration and invasion via increased expression of VCAM1 and VEGF. Our findings therefore highlight NOX4 as a potential treatment target in RA.

DAS28: 28-joint Disease Activity Score; FITC: Fluorescein isothiocyanate; FLS: Fibroblast-like synoviocytes; HC: Healthy control subjects; ICAM1; intercellular adhesion molecule 1; IL-17: Interleukin 17; MFI: Mean fluorescence intensity; NADPH: nicotinamide adenine dinucleotide phosphate; NCAM1: neural cell adhesion molecule 1; NOX: Nicotinamide adenine dinucleotide phosphate oxidase; OA: osteoarthritis; PBMC: Peripheral blood mononuclear cell; PE-PC5: Phycoerythrin-cyanine 5; RA: Rheumatoid arthritis; ROS: Reactive oxygen species; TNF-a: Tumor necrosis factor alpha; VCAM-1: induced vascular cell adhesion molecule 1; VEGF: Vascular endothelial growth factor

Ethics approval and consent to participate

This study was performed according to the recommendations of the Declaration of Helsinki and approved by the Institutional Review Board of Chungnam National University Hospital (CNUH 2015-10-052).

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Conflict of interests

The authors have declared no conflicting interests.

Funding

This work was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2016R1D1A1B03931637 and NRF-2019R1I1A1A01046493).

Authorship Contributions

Conception and design: H-R. Lee, Su-Jin Yoo, and Seong Wook Kang; Development of methodology: H-R. Lee, Jinhyun Kim, In Seol Yoo, and Chan Keol Park; Acquisition of data: H-R. Lee and Su-Jin Yoo; Analysis and interpretation of data: H-R. Lee, Su-Jin Yoo, Jinhyun Kim, In Seol Yoo, Chan Keol Park and Seong Wook Kang; Writing, review, and/or revision of the manuscript: H-R. Lee, Su-Jin Yoo, and Seong Wook Kang

Acknowledgements

Not applicable

Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, Healey LA, Kaplan SR, Liang MH, Luthra HS et al: The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum 1988, 31(3):315-324.
Klareskog L, Catrina AI, Paget S: Rheumatoid arthritis. Lancet 2009, 373(9664):659-672.
McInnes IB, Schett G: The pathogenesis of rheumatoid arthritis. N Engl J Med 2011, 365(23):2205-2219.
Bartok B, Firestein GS: Fibroblast-like synoviocytes: key effector cells in rheumatoid arthritis. Immunol Rev 2010, 233(1):233-255.
Bustamante MF, Garcia-Carbonell R, Whisenant KD, Guma M: Fibroblast-like synoviocyte metabolism in the pathogenesis of rheumatoid arthritis. Arthritis Res Ther 2017, 19(1):110.
Phull AR, Nasir B, Haq IU, Kim SJ: Oxidative stress, consequences and ROS mediated cellular signaling in rheumatoid arthritis. Chem Biol Interact 2018, 281:121-136.
Mateen S, Moin S, Khan AQ, Zafar A, Fatima N: Increased Reactive Oxygen Species Formation and Oxidative Stress in Rheumatoid Arthritis. PloS one 2016, 11(4):e0152925.
Sena LA, Chandel NS: Physiological roles of mitochondrial reactive oxygen species. Mol Cell 2012, 48(2):158-167.
Boveris A, Chance B: The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J 1973, 134(3):707-716.
Gorlach A, Brandes RP, Nguyen K, Amidi M, Dehghani F, Busse R: A gp91phox containing NADPH oxidase selectively expressed in endothelial cells is a major source of oxygen radical generation in the arterial wall. Circ Res 2000, 87(1):26-32.
Pendyala S, Gorshkova IA, Usatyuk PV, He D, Pennathur A, Lambeth JD, Thannickal VJ, Natarajan V: Role of Nox4 and Nox2 in hyperoxia-induced reactive oxygen species generation and migration of human lung endothelial cells. Antioxid Redox Signal 2009, 11(4):747-764.
Sun X, Wei J, Tang Y, Wang B, Zhang Y, Shi L, Guo J, Hu F, Li X: Leptin-induced migration and angiogenesis in rheumatoid arthritis is mediated by reactive oxygen species. FEBS Open Bio 2017, 7(12):1899-1908.
Chabaud M, Garnero P, Dayer JM, Guerne PA, Fossiez F, Miossec P: Contribution of interleukin 17 to synovium matrix destruction in rheumatoid arthritis. Cytokine 2000, 12(7):1092-1099.
Xu T, Ying T, Wang L, Zhang XD, Wang Y, Kang L, Huang T, Cheng L, Wang L, Zhao Q: A native-like bispecific antibody suppresses the inflammatory cytokine response by simultaneously neutralizing tumor necrosis factor-alpha and interleukin-17A. Oncotarget 2017, 8(47):81860-81872.
Hueber AJ, Asquith DL, Miller AM, Reilly J, Kerr S, Leipe J, Melendez AJ, McInnes IB: Mast cells express IL-17A in rheumatoid arthritis synovium. J Immunol 2010, 184(7):3336-3340.
Lefevre S, Knedla A, Tennie C, Kampmann A, Wunrau C, Dinser R, Korb A, Schnaker EM, Tarner IH, Robbins PD et al: Synovial fibroblasts spread rheumatoid arthritis to unaffected joints. Nat Med 2009, 15(12):1414-1420.
Wluka AE, Ding C, Jones G, Cicuttini FM: The clinical correlates of articular cartilage defects in symptomatic knee osteoarthritis: a prospective study. Rheumatology (Oxford) 2005, 44(10):1311-1316.
Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, Bingham CO, 3rd, Birnbaum NS, Burmester GR, Bykerk VP, Cohen MD et al: 2010 Rheumatoid arthritis classification criteria: an American College of Rheumatology/European League Against Rheumatism collaborative initiative. Arthritis Rheum 2010, 62(9):2569-2581.
Pap T, Muller-Ladner U, Gay RE, Gay S: Fibroblast biology. Role of synovial fibroblasts in the pathogenesis of rheumatoid arthritis. Arthritis Res 2000, 2(5):361-367.
Qu F, Guilak F, Mauck RL: Cell migration: implications for repair and regeneration in joint disease. Nat Rev Rheumatol 2019, 15(3):167-179.
Hamilton JL, Nagao M, Levine BR, Chen D, Olsen BR, Im HJ: Targeting VEGF and Its Receptors for the Treatment of Osteoarthritis and Associated Pain. J Bone Miner Res 2016, 31(5):911-924.
Dong A, Shen J, Zeng M, Campochiaro PA: Vascular cell-adhesion molecule-1 plays a central role in the proangiogenic effects of oxidative stress. Proc Natl Acad Sci U S A 2011, 108(35):14614-14619.
Segal BH, Leto TL, Gallin JI, Malech HL, Holland SM: Genetic, biochemical, and clinical features of chronic granulomatous disease. Medicine (Baltimore) 2000, 79(3):170-200.
Alzabin S, Abraham SM, Taher TE, Palfreeman A, Hull D, McNamee K, Jawad A, Pathan E, Kinderlerer A, Taylor PC et al: Incomplete response of inflammatory arthritis to TNFalpha blockade is associated with the Th17 pathway. Ann Rheum Dis 2012, 71(10):1741-1748.
Fischer JA, Hueber AJ, Wilson S, Galm M, Baum W, Kitson C, Auer J, Lorenz SH, Moelleken J, Bader M et al: Combined inhibition of tumor necrosis factor alpha and interleukin-17 as a therapeutic opportunity in rheumatoid arthritis: development and characterization of a novel bispecific antibody. Arthritis Rheumatol 2015, 67(1):51-62.
Honorati MC, Meliconi R, Pulsatelli L, Cane S, Frizziero L, Facchini A: High in vivo expression of interleukin-17 receptor in synovial endothelial cells and chondrocytes from arthritis patients. Rheumatology (Oxford) 2001, 40(5):522-527.
Snelling SJ, Bas S, Puskas GJ, Dakin SG, Suva D, Finckh A, Gabay C, Hoffmeyer P, Carr AJ, Lubbeke A: Presence of IL-17 in synovial fluid identifies a potential inflammatory osteoarthritic phenotype. PloS one 2017, 12(4):e0175109.
Ushio-Fukai M, Nakamura Y: Reactive oxygen species and angiogenesis: NADPH oxidase as target for cancer therapy. Cancer Lett 2008, 266(1):37-52.
Yamamura Y, Gupta R, Morita Y, He X, Pai R, Endres J, Freiberg A, Chung K, Fox DA: Effector function of resting T cells: activation of synovial fibroblasts. J Immunol 2001, 166(4):2270-2275.
Tang Y, Wang B, Sun X, Li H, Ouyang X, Wei J, Dai B, Zhang Y, Li X: Rheumatoid arthritis fibroblast-like synoviocytes co-cultured with PBMC increased peripheral CD4(+) CXCR5(+) ICOS(+) T cell numbers. Clin Exp Immunol 2017, 190(3):384-393.
Vendrov AE, Vendrov KC, Smith A, Yuan J, Sumida A, Robidoux J, Runge MS, Madamanchi NR: NOX4 NADPH Oxidase-Dependent Mitochondrial Oxidative Stress in Aging-Associated Cardiovascular Disease. Antioxid Redox Signal 2015, 23(18):1389-1409.
Piera-Velazquez S, Jimenez SA: Role of cellular senescence and NOX4-mediated oxidative stress in systemic sclerosis pathogenesis. Curr Rheumatol Rep 2015, 17(1):473.
Huber LC, Distler O, Tarner I, Gay RE, Gay S, Pap T: Synovial fibroblasts: key players in rheumatoid arthritis. Rheumatology (Oxford) 2006, 45(6):669-675.
Lin XL, Yang L, Fu SW, Lin WF, Gao YJ, Chen HY, Ge ZZ: Overexpression of NOX4 predicts poor prognosis and promotes tumor progression in human colorectal cancer. Oncotarget 2017, 8(20):33586-33600.
Zhao H, Zhang M, Zhou F, Cao W, Bi L, Xie Y, Yang Q, Wang S: Cinnamaldehyde ameliorates LPS-induced cardiac dysfunction via TLR4-NOX4 pathway: The regulation of autophagy and ROS production. J Mol Cell Cardiol 2016, 101:11-24.
Yu MH, Li X, Li Q, Mo SJ, Ni Y, Han F, Wang YB, Tu YX: SAA1 increases NOX4/ROS production to promote LPS-induced inflammation in vascular smooth muscle cells through activating p38MAPK/NF-kappaB pathway. BMC Mol Cell Biol 2019, 20(1):15.

Table 1. Primers used for PCR

	Sense primer	Antisense primer
*NOX1*	GTTTTACCGCTCCCAGCAGAA	GGATGCCATTCCAGGAGAGAG
*NOX2*	CAAGATGCGTGGAAACTACCTAAGAT	TCCCTGCTCCCACTAACATCA
*NOX3*	ACCGTGGAGGAGGCAATTAGACAA	CAGGTTGAAGAAATGCGCCACGAT
*NOX4*	CTCAGCGGAATCAATCAGCTGTG	AGAGGAACACGACAATCAGCCTTAG
*NOX5*	ATCAAGCGGCCCCCTTTTTTTCAC	CTCATTGTCACACTCCTCGACAGC
*DUOX1*	TTCACGCAGCTCTGTGTCAA	AGGGACAGATCATATCCTGGCT
*p22phox(CYBA)*	CGCTGGCGTCCGCCTGATCCTCA	ACGCACAGCCGCCAGTAGGTAGAT
*p67phox(NCF2)*	ATCAGCCTCTGGAATGAAGGGG	GCAGCCAATGTTGAAGCAAATCC
*GAPDH*	CACATGGCCTCCAAGGAGTAA	TGAGGGTCTCTCTCTTCCTCTTGT

Download PDF

Journal Publication

published 15 May, 2020

Read the published version in Arthritis Research & Therapy →

Editorial decision: Major revision
23 Mar, 2020
Review #2 received at journal
19 Mar, 2020
Editor assigned by journal
17 Mar, 2020
Reviewers invited by journal
17 Mar, 2020
Reviewer #1 agreed at journal
17 Mar, 2020
Reviewer #2 agreed at journal
17 Mar, 2020
Review #1 received at journal
17 Mar, 2020
Submission checks completed at journal
16 Mar, 2020
Editor invited by journal
16 Mar, 2020

You are reading this older preprint version

Read the latest preprint version →

The effect of nicotinamide adenine dinucleotide phosphate oxidase 4 on migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis

Status:

Journal Publication

Version 2

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Status:

Journal Publication

Version 2