Cell culture, reagents, and antibodies
Human HCC cell lines Huh7, HepG2 and SK-Hep1 obtained from The Chinese Academy of Sciences in Shanghai-China were used. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (Gibco, Shanghai, China) and 1% penicillin/streptomycin and maintained in an incubator with a humidified atmosphere of 5% CO2 at 37°C30,31. Sorafenib and UO126 (Sigma-Aldrich, St. Louis, Missouri, USA) were purchased and dissolved in 100% DMSO to prepare a 10mM stock solution, which was then diluted with DMEM to the desired concentration, with a final concentration of 0.1% DMSO, recommended for in vitro studies. Unless otherwise stated, all antibodies were obtained from Life Span BioSciences (LSBIO, Seattle, Washington, USA)32. The enhanced chemiluminescence detection kit was purchased from Amersham Pharmacia Biotech-UK. The primers for AQP3 and GAPDH were obtained from Sangon Biotech (Sangon Biotech, Shanghai, China). SYBR® Premix Ex Taq™ (Tli RNaseH Plus) was purchased from Takara Bio Inc (Takara, Beijing, China).
Cell proliferation assay
Cell count Kit-8 (CCK-8) was used to detect differences in cell proliferation (Sigma-Aldrich, St. Louis, Mo., USA). Briefly, cells were seeded in a 96-well plate at a density of 3000 cells/well and incubated for different time (0, 24, 48, and 72 h). After the indicated time, 10μl of CCK-8 solution was added to each well of the plate, followed by 2 h incubation before detecting absorbance at 450nm using a microplate reader. Cell viability (as a percentage) was determined in relation to the average absorbance of the untreated cells from three replicate samples.
Annexin V apoptosis assay
Annexin V apoptosis was used to detect apoptosis differences. Briefly, cells were seeded in 6-well plates at 2 ´ 105 per well for 24 h prior to treatment. After treatment/transfection, cells were harvested via trypsinization, washed twice with Phosphate buffered saline (PBS), and stained with a fluorescein isothiocyanate Annexin V Apoptosis Detection kit (BD Pharmingen, Franklin Lakes, NJ, USA). Flow cytometry (Thermo Fisher Scientific, Waltham, Massachusetts, USA) was used to determine the proportion of apoptosis.
Flow cytometry Cell cycle analysis
Flow cytometry was used to detect differences in cell cycle progression in accordance with Sigma-Aldrich CCK-8 protocol Number 96992. Briefly, cells were seeded in 6-well plates at 2 x 105 per well. After transfection, cells were harvested by trypsinization and washed with PBS 2x. Cells were fixed in cold 70% ethanol for 24 h at 4oC, washed with PBS 2x, resuspended in 1mL PBS; treated with 10μL RNase A (21 mg/mL); and then stained with 5 μL propidium iodide at 1mg/mL for 30 minutes at room temperature. Finally, the stained cells were analyzed by flow cytometry (Thermo Fisher Scientific, Waltham, Massachusetts, USA).
Cell transfection
Cells were plated in 6-well plates until 60% confluence and then infected with lentivirus-AQP3 (Lv-AQP3), lentivirus-AQP3RNAi (Lv-AQP3RNAi), or lentivirus-GFP (Lv-GFP)-control according to the company instructions (GenePharma Co. Ltd, Shanghai, China)32. Transfection efficiency was verified under fluorescence microscope after 14 h. The cells with stable virus integration 48 h posttransfection were selected with puromycin and further incubated for 10 days. The effect of transfection on AQP3 expression was verified via qPCR and western blotting.
Protein extraction and western blotting
Protein was extracted using RIPA lysis buffer (Pierce Biotechnology Inc, Rockford, Illinois, USA). Protein concentration was determined via the bicinchoninic acid protein assay as per the Bio-Protocol (bio-protocol, Philadelphia, Pennsylvania, USA). An equivalent of 30μg of the protein extract was resolved via sodium dodecyl sulfate polyacrylamide gel electrophoresis and electro transferred (wet) to polyvinylidene difluoride membranes (EMD Millipore Corporation, Billerica, Massachusetts, USA)32. The membranes were initially blocked with 5% BSA in TBST (137mM NaCl, 20mM Tris HCl [pH 7.6], and 0.1% [v/v] Tween 20) for 1 h, followed by incubation overnight at 4°C with primary antibodies (1:1000) against AQP3, Erk, p-Erk, Akt, p-Akt, p53, p-p53, p21, cyclin-dependent kinase 2 (CDK2), cyclin-dependent kinase 4 (CDK4), and GAPDH/beta-tubulin (as loading controls). The membranes were washed with PBS 3x each 5 min and then incubated with Horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2000) at room temperature for 1 h. Immunodetection was performed using an ECL Western Blotting Detection Kit (Beyotime, Shanghai, China). The relative protein expression levels were quantified by densitometric measurement of ECL reaction bands and normalized to GAPDH/beta-tubulin levels32.
RNA extraction, reverse transcription, and qPCR
Total RNA was extracted from cells using an RNAIsoPlus assay kit (Takara, Dalian, China) according to the manufacturer’s instructions. After quantification, RNA was transcribed into cDNA using a two-step reverse transcription kit (Takara, Dalian, China). Subsequently, qPCR was used to detect target gene expression levels using the SYBR-Green qPCR master mix (Takara, Dalian, China). The thermocycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 35 cycles of a two-step PCR of 95°C for 14 s and 60°C for 1 min. The 2ΔΔCq method was used to quantify the results; the relative expression level of AQP3 was normalized to that of GAPDH. The primers used were as follows: AQP3, forward (F), 5ʹ–GGCTGTATTATGATGCAATCT–3ʹ and reverse (R), 5ʹ–ATATCCAAGTGTCCAGAGG–3ʹ. GAPDH F, 5ʹ–GATCATCAGCAATGCCTCCT–3ʹ and R, 5ʹ–GAGTCCTTCCACGATACCAA–3ʹ. The data have been deposited in a publicly accessible database (GenBank) with accession number NM_004925.5 and NM_002046.7 for AQP3 and GAPDH, respectively32.
Statistical analysis
Statistical analyses were performed using SPSS 21.0. Parametric data are presented as the mean±standard deviation (SD). Between-group differences were analyzed using Student’s t test. Significance was set at P < 0.05(*), < 0.01(**), or < 0.001(***).