Tumor tissue specimens
Forty pairs of tumor and distal normal tissue samples were prospectively collected from surgically excised specimens of patients with ESCC at the Affiliated Cancer Hospital of Xinjiang Medical University (Urumqi, China) between July and December 2016. The tumor and distal tissues were frozen in liquid nitrogen immediately following resection. All patients in the current study did not received chemotherapy or radiation therapy prior to surgery. The study was approved by the Ethics Committee of the Affiliated Cancer Hospital of Xinjiang Medical University. Written informed consent was provided by the families of all of the patients.
Cell culture
ECA109 cell line was obtained from the Cell Bank of Xinjiang Medical University (Urumqi, China). KYSE450 cell line was purchased from the Cell Bank of the Chinese Academy of Sciences. ECA109 and KYSE450 cells were cultured in RPMI1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% heatinactivated fetal bovine serum (FBS; Zhejiang Tianhang Biological Technology Co., Ltd., Zhejiang, China), 100 units/ml penicillin, and 100 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C in a humidified 5% CO2 atmosphere.
GV142‑survivin overexpression plasmid construction
The GV142 plasmid was purchased from GeneChem Co., Ltd. (Shanghai, China). For the GV142-survivin overexpression and GV142-control plasmid construction, GV227 (GeneChem Co., Ltd.) was used as the template, and the survivin and control polymerase chain reaction (PCR) primers used are presented in Table 2. The resulting PCR products were inserted into the GV142 vector between HindIII and XhoI sites, yielding GV142-survivin overexpression and GV142-control plasmids.
Table 2
Primers for GV142-survivin overexpression and control plasmid construction.
Target gene | Primers 5’→3’ |
Forward | Reverse |
Survivin | TGCCAAGCTTATGGGTGCCCCGACGTTGC | TCCGCTCGAGTATCCATGGCAGCCAGCTGCTC |
Control | TTATGGGTGCCCCGACGTTGC | TCCGCTCGAGTATCCTGCCAAGCATGGCAGCCAGCTGCTC |
LV3‑survivin shRNA plasmid constructs
The LV3 vector was purchased from Shanghai GeneChem Co., Ltd. (Shanghai, China). The sequences of small shRNA targeting survivin were designed as follows: GAAAGTGCGCCGTGCCATCTTCAAGAGAGATGGCACGGCGCACTTTCTT. The sequences of negative control were designed as follows: GCGCGCACAATCTACGCTAGTTTCAAGAGAACTAGCGTAGATTGTGCGCGCTT. The sequences were inserted between the HindIII and XhoI sites of the LV3 vector chemically synthesized by Shanghai GeneChem Co., Ltd. The constructs were verified by DNA sequence analysis.
Plasmid transfection
Prior to electroporation, KYSE450 and Eca109 cells were ensured in exponential growth phase. Culture medium was removed and replaced with fresh serum-free Opti-MEMI medium. Cells were clicked and re-suspended before centrifugation. After centrifugation the supermatant was discarded. This step was repeated twice. 400 ul cell suspension was transferred into electroporation cuvette. Then plasmid was added to cuvette. The cuvette was subjected to the electroporation (500 V, 15 ms and square wave). After electroporation, the cells were transferred into 6-well plate containing complete medium to culture. Transfection efficiency was checked 24 hours after transfection by watching the glowing cell under fluorescence microscope because the plasmid contained the fluorescent protein gene.
Groups of cell infected with plasmids
Cancer cells including KYSE450 and ECA109 were divided into three groups both in survivin overexpression and knock-down experiment. Groups in survivin overexpression are UP group, NC group and BC group. Cells in the UP group were transfected with GV142-survivin. Cells in the NC group were transfected with GV142-negative control. BC group meaning blank control, Cells in the BC group were not treated with any plasmid during the electroporation. Groups in survivin knockdown are KD group, NC group and BC group. Cells in the KD group were transfected with LV3-survivin shRNA. Cells in the NC group were transfected with LV3-negative control. Cells in the BC group were not treated with any plasmid during the electroporation.
RT-PCR for analysis of mRAN from patient’s tissue
Total RNA was isolated with TriZOL (Thermo Fisher Scientific, Inc.) following instructions provided by manufacturer. Specific PCR products were generated using the following primers: Survivin: forward primer 5’-CCCTGCCTGGCAGCCCTTTC-3’ and reverse primer 5’-CTGGCTCCCAGCCTTCCA-3’; Bad: forward primer 5’-CAGAGTTTGAGCCGAGTGAGC-3’ and reverse primer 5’-CCCATCCCTTCGTCGTCCT-3’; GAPDH: forward primer 5’-GGGAAACTGTGGCGTGAT-3’ and reverse primer 5’-AAAGGTGGAGGAGTGGGT-3’. RNA samples were quantified with ultraviolet spectrophotometer and severed as templates to generate cDNA.
Real-Time quantitative PCR for analysis of cellular mRNA
48 hours after transfection, total cellular RNA extraction from cultured cell lines was performed using TRIzol (Thermo Fisher Scientific, Inc.) following instructions provided by manufacturer. One µg of total RNA extracted from the cells was subjected to reverse transcription. Maloney Murine Leukemia Virus Reverse Transcriptase (Promega Corporation, Madison, WI, USA) was used for cDNA synthesis. Specific primers were as following. Survivin: forward primer 5’-CCCTGCCTGGCAGCCCTTTC-3’ and reverse primer 5’-CTGGCTCCCAGCCTTCCA-3’; Bad: forward primer 5’-CAGAGTTTGAGCCGAGTGAGC-3’ and reverse primer 5’-CCCATCCCTTCGTCGTCCT-3’; Caspase-3: forward primer 5’-GCTATTGTGAGGCGGTTGT-3’ and reverse primer 5’-AGCAGGGCTCGCTAACTC − 3’; Caspase-9: forward primer 5’-CGAACTAACAGGCAAGCA-3’’ and reverse primer 5’-GCACCGACATCACCAAAT-3’; GAPDH: forward primer 5’-GGGAAACTGTGGCGTGAT-3’ and reverse primer 5’-AAAGGTGGAGGAGTGGGT-3’. Real-time PCR (RT-qPCR) was used to quantify the expression level of the Survivin, Bad, Caspase-3 and Caspase-7 gene in the ESCC cell lines ECA109 and KYSE450 using the TaqMan® Fast Virus 1-Step Master mix kit (Thermo Fisher Scientific, Inc.)., according to the protocol supplied by manufacturer. Amplification conditions were as follows: 2 min at 50˚C, 2 min at 95˚C, 15 sec at 95˚C, 15 sec at 55‑60˚C, 1 min at 72˚C. The relative quantification transcript levels were calculated using the 2-ΔΔCq method. The experiments were performed in triplicate for each cell line and results are presented as the mean ± standard deviation.
Western blotting assay
Forty-eight hours after transfection, attached and floating cells were harvested on ice. The cells were washed with cold PBS and subsequently lysed in cold RIPA lysis buffer [1 M Tris HCl (pH 7.4), 5M NaCl, 0.5 M ethylene glycol tetraacetic acid, 0.5 M EDTA, NP-40, 10% SDS (Wuhan Boster Biological Technology, Ltd., Wuhan, China), glycerine, 10 µg/µl aprotinin, 10 µg/µl leupeptin, 10 µg/µl Pepstatin A, 10 mM phenylmethylsulfonyl fluoride, double-distilled H2O] for 30 min on ice. Clear protein extracts were obtained by centrifugation at 18,407 x g for 15 min at 4˚C. Protein concentrations were determined by Pierce BCA protein assay (Thermo Fisher Scientific, Inc.) and 20 mg of protein mixed with loading buffer was loaded per lane, and separated by 10–15% polyacrylamide gels (Wuhan Boster Biological Technology, Ltd.). Proteins were transferred to PVDF membranes. Nonspecific binding was blocked by blocked with 5% non-fat dried milk (Sigma-Aldrich) in Tris-buffered saline and Tween-20 (TBST; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) at room temperature for 2 h. Membranes were incubated with the primary antibody overnight at 4˚C. The primary antibodies include rabbit anti-survivin, anti-Bad, anti-Bad, anti-Caspase 3, anti-Caspase 7 and anti-GAPDH served as a loading control. Then the membranes were washed three times with TBST at room temperature and incubated with appropriate horseradish peroxidase-linked goat anti-rabbit secondary antibodies at a dilution of 1:1,000 (cat. no. BA1054; WuhanBoster Biological Technology, Ltd.) diluted in TBST for 1 hat room temperature. The immunoreactive bands were visualized using an Enhanced Chemiluminescence Detection kit (Thermo Fisher Scientific, Inc.).
Cycle and cell apoptosis analysis by flow cytometry
ECA109 and KYSE450 cells were directly incubated, at 37˚C for 48 h, in 6well plates and collected 48 h after transfection. Then, the cells were treated with the indicative reagent propidium iodide (PI) and Annexin V staining kit (BestBio Co. Ltd.). For the cell cycle analysis, the cells were washed with phosphate buffered saline (PBS) for 5 min and subsequently centrifugation at 900 g. The cells were collected and fixed in icecold 70% ethanol for 2 hours at 4˚C, followed by treatment with 0.2 mg/ml RNase A (EMD Millipore) in PBS for 30 min at 37˚C. PI was added (final concentration, 25 µg/ml) and the cells were incubated for 30 min at 4˚C in the dark prior to cell cycle analysis. Analysis of the samples was performed within 24 h. To determine the apoptosis rate, the transfected cells were washed twice with icecold PBS, and resuspended in 195 µl 1X Binding Buffer (EMD Millipore) to a concentration of 1 × 104 cells/ml. Annexin V (5 µl) and PI were gently mixed with the cells and incubated for 15 min at room temperature in the dark. The dyes were washed out by centrifugation for 5 min at 94 x g and the cells were resuspended in 190 µl 1X Binding Buffer. PI staining solution (10 µl) was gently mixed in and incubated on ice and in the dark. The samples were analyzed within 1 h. All samples for the two assays consisted of 10,000 cells and were analyzed by fluorescenceactivated cell sorting with a BD FACSMicroCount™ system (BD Biosciences, Franklin Lakes, NJ, USA). The experiments were performed independently in triplicate for each cell line.
Chromatin immunoprecipitation assay (ChIP)
To determine whether survivin binds to the Bad promoter region, ChIP assays were performed using the ChIP kit (EPIGENTEK, USA) according to the manufacturer's protocols. DNA and proteins in ECA109 and KYSE450 cells were cross-linked by treatment with 1% formaldehyde (Sigma-Aldrich) for 10 min. The cells were washed twice with 1X PBS, lysed, and sonicated to reduce DNA lengths to within the range of 200-1,000 bp. Immunoprecipitation was then performed using 4 µg rabbit antibody against survivin to incubate. The group which incubated with normal mouse IgG served as the negative control. The group which incubated with 1 µl Anti-RNA Polymerase II (dilution, 1:1,000) served as the positive control. The immune complexes were precipitated, eluted, reverse-crosslinked and treated with proteinase K [Tiangen Biotech (Beijing) Co.,Ltd., Beijing, China]. The primers designed to amplify various regions of the human Bad gene promoters were as follows: region 1(196 bp): 5’-GAGGTTCATAAGCGTCAAGGT-3’(forward) and 5’-GTATGGGCACAAGCGTCTC-3’(reverse); region 2 (252 bp): 5’-CCTTCGCCCGCAGTAATC-3’ (forward) and 5’-CCTCGTCCGCATCCTTTT-3’ (reverse); region 3(431 bp): 5’-CTGGGCAAAGTAGAGGTTCAT-3’(forward) and 5’-TCCGTATTTATTTCCCTGGTC-3’ (reverse); region 4(490): 5’-CTGGGCAAAGTAGAGGTTCAT − 3’(forward) and 5’-TCCGTATTTATTTCCCTGGTC-3’ (reverse). The group which did not add any primers served as the primer blank control. PCR fragments were separated and visualized on 1.8% agarose gels stained with ethidium bromide (Shanghai Bioleaf Biotech Co., Ltd., Shanghai, China). All ChIP assays were performed independently in triplicate and the most representative results are illustrated in the figures.
Statistical analysis
All statistical analyses were performed with SPSS version 17.0 for Windows (SPSS, Inc., Chicago, IL, USA). Difference and correlation were analyzed by χ2 test. P < 0.05 was considered statistically significant. Data (mRNA/protein levels, cell cycle, and cell apoptosis) were expressed as the mean ± standard deviation from three independent experiments. Data were analyzed by one-way analysis of variance followed by the LSD post hoc test used to compare mean differences in two groups. P < 0.05 was considered to indicate a statistically significant difference.