Molecular epidemiological surveillance of Africa and Asia imported malaria in Wuhan, Central China: comparison of diagnostic tools during 2011–2018

doi:10.21203/rs.2.20803/v1

Download PDF

Research

Molecular epidemiological surveillance of Africa and Asia imported malaria in Wuhan, Central China: comparison of diagnostic tools during 2011–2018

https://doi.org/10.21203/rs.2.20803/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 03 Sep, 2020

Read the published version in Malaria Journal →

Version 1

posted

You are reading this latest preprint version

Background Malaria remains a serious public health problem globally. Along with indigenous malaria elimination in China, imported malaria gradually became a major hazard. Well-timed and accurate diagnosis could support immediate therapeutic schedule, reveal the prevalence of imported malaria and avoid the disease transmission.

Method Blood samples were collected in Wuhan, China from August 2011 to December 2018. All patients first accepted microscopy and RDT examination. Subsequently, each of the positive or suspected positive cases was engaged in total four human Plasmodium species amplication by using 18S rRNA based nested PCR and Taqman probe based real-time PCR. Then performance of microscopy and two molecular diagnosis methods were analyzed. Importation origin was traced by country and prevalence of Plasmodium species was revealed by year.

Results Total 296 blood samples containing 288 microscopy and RDT positive, 7 RDT P. falciparum positive and 1 suspected cases were collected and reanalyzed. After two molecular methods and sequencing detection, 291 cases including 245 P. falciparum , 15 P. vivax , 20 P. ovale , 6 P. malariae and 5 mixed infection (3 P. falciparum + P. ovale , 2 P. vivax + P. ovale ) were confirmed. These patients returned from Africa (95.53%) and Asia (4.47%). Although the prevalence displayed a small-scale fluctuation, the overall trend of the imported cases increased yearly.

Conclusions Results emphasized the necessity of combined utilization of the four tools for malaria diagnosis in clinic and field survey around potential risk regions worldwide including Wuhan.

Parasitology

Molecular Epidemiology

Imported malaria

Microscopic examination

Molecular diagnosis

Rapid diagnosis test

Nested PCR

Real-time PCR

Malaria remains a serious threat to publics around the world with an estimated 219 million cases and 435,000 deaths in 2017 worldwide [1]. The mainly epidemic areas of malaria distribute in tropical and subtropical regions, especially in Sub-saharan Africa and Southeast Asia (SEA) [1]. World Health Organization hopes to eliminate malaria in at least 35 new countries (based on data from 2015) by 2030 [2]. In order to achieve the goal, China plans to eliminate the disease in 2020 [3]. In China, the occurrence and burden of indigenous malaria have rapidly shrunk attributes to employment of the integrated malaria control and elimination strategy since 2000 [4]. It is note that no indigenous malaria in 2017 was reported in the whole country. In accordance with the nationwide status, control of indigenous malaria in Hubei Province of China also achieved remarkable effect. Indigenous malaria case reported in Hubei was zero since 2013. However, imported malaria gradually became a major threat along with the process of prevention, control and elimination in endemic and non-endemic areas globally including China. Furthermore, it is worth mentioning that imported malaria cases from Africa region and SEA were gradually increasing yearly in China including the provincial capital of Hubei province, Wuhan [4, 5]. For efficient control and achieving malaria eradication before 2020 in China as the state plan [3], imported malaria patients in China, especially first-tier cities with high population density and mobility like Wuhan should be highly noticed.

For human being, there are five primary Plasmodium species causing malaria, including P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi. Different Plasmodium species infection caused dissimilar disease characteristics. Amongst them, P. falciparum is responsible for most of morbidity and mortality of humans [6]. P. vivax is generally the culprit for majority of malaria cases in areas with tropical and temperate climates and considered as one of the neglected tropic diseases [7, 8]. P. ovale seldom leads to severe malaria for people in endemic regions, but can arouse severe malaria disease for naive visitors [9, 10]. It is comprised of two subspecies, the classic type named as P. ovale curtisi and variant type named as P. ovale wallikeri [11]. P. ovale curtisi was demonstrated possessing significantly longer latency duration than that in P. ovale wallikeri [12, 13]. P. malariae usually causes the mildest infections, but may also account for splenomegaly or renal damage after chronic infection [14]. As the fifth species of Plasmodium causing malaria in humans, P. knowlesi is initially found from SEA in nature macaques [15]. Beyond that, simultaneous infections more than one human Plasmodium species commonly happen, especially in endemic regions [16]. However, influence of malaria caused by P. vivax, P. ovale and P. malariae as well as mixed infection was actually frequently underestimated [10, 13, 17, 18, 19]. Therefore, in order for timely and efficient treatment and preventing malaria transmission, early and accurate diagnosis of Plasmodium species infection was meaningful.

Due to inexpensive spends, relative high sensitivity in species recognition and even parasite density quantification, microscopic examination of thick and thin blood smear is traditionally regarded as the gold standard for malaria detection [20, 21]. However, the use of microscopic examination has been restricted because it requires well-trained laboratory personnel and shows less sensitive at low parasitaemia [22, 23, 24]. Actually, different observers may make two to three fold discrepancies in parasite quantification [25]. More importantly, mixed infections of different Plasmodium species were frequently missed [26]. Two subspecies of P. ovale (P. ovale curtisi and P. ovale wallikeri) are usually difficult to be distinguished by microscopy. Misidentification may also happen between different species [27]. All above may induce the unreasonable usage of antimalarial drugs and then hamper the parasite clearance and lead to the transmission of malaria, even antimalarial drug resistance. Rapid diagnosis test (RDT) as an immunologic method usually targets on Plasmodium specific antigens in blood samples such as histidine-rich protein 2 (HRP2) and lactate dehydrogenase (LDH) [14]. For RDT, it offers rapid diagnosis, even could be conducted by users without extensive training. And it often has comparable sensitivity as microscopy. However, RDT could only distinguish falciparum and non-falciparum Plasmodium species infection [28]. Futhermore, false negative results by RDT were also reported in previous studies [29, 30, 31]. Therefore, molecular tools such as nested PCR and real-time PCR that could not only detect Plasmodium infection, but also allow accurate species identification by primer design should be involved. Based on two rounds of amplification, nested PCR can evidently improve the detection sensitivity. Sequencing of products from nested PCR represents a further reliable guarantee for species identification just as in other studies [32, 33]. The major advantages of real-time PCR include direct result reading without downstream analysis and quantification of DNA copy number [34, 35].

Using suitable and effective methods to timely finding the imported malaria is the guarantee of successful completing the target assessment task for malaria elimination in China, Africa and SEA. In present study, Plasmodium species in all imported malaria cases in Wuhan were confirmed by using microscopy, RDT, nested PCR and real-time PCR and their performances in malaria diagnosis were assessed. Analysis of the diagnostic results also revealed the prevalence characteristics of imported malaria in Wuhan, China.

Collection of study specimens

Blood samples from clinically-suspected patients with manifestation or symptoms of malaria were accumulatively collected from Center for Disease Prevention and Control (CDC) of Wuhan, China, during August 2011 to December 2018. About 2–5 ml blood was drawn from each patient for microscopy and RDT testing and 400 µl of each sample was stored on 3 MM Whatman filter paper for molecular verification. Ethical approval for this study was obtained from the Medical Ethics Committee of the Hubei University of Medicine and Wuhan CDC. Informed consent was supplied by all participating individuals.

Microscopic examination and RDT assay

Blood samples were first subjected to One Step Malaria HRP2/pLDH (P.f/Pan) (Wondfo, Guangzhou, China) detection. Subsequently, thick and thin peripheral blood smears were made by the standard method [36]. Giemsa staining and microscopic examinations were conducted by professionals in Wuhan CDC. Parasitemia (parasites/µl) was determined according to our previous documents [37]. No asexual form of Plasmodium in 200 high-power fields in the thin blood films or on parasites even in each 1000 white blood cells were considered as negative [36, 38].

Genomic DNA extraction

Genomic DNA (gDNA) from the microscopic-positive or suspected positive blood samples was extracted using a TIANamp blood DNA kit (Tiangen Biotech Co., Ltd., Beijing, China). Briefly, approximately 130 µl peripheral blood (6 mm × 6 mm blood spot) was treated following manufacturer’s instruction and finally dissolved in 50 µl elution buffer. After quantification with Gene 5, the purified gDNA was packed as aliquots and stored at -20 °C until further use.

Taqman probe based Real-time PCR

The parasite species including P. falciparum, P. vivax, P. ovale (P. ovale curtisi, P. ovale wallikeri) and P. malariae were designed to be distinguished with real-time PCR. The preparation of primers and Taqman probes was according to the previous documents [32, 39] (primers list in Table 1). Reaction was performed using the Premix EX Taq ^TM probe qPCR (Takara, Japan) following the manufacturer’s instruction. Briefly, a reaction mixture was consist of 12.5 µl premix Ex Taq (2×), 0.5 µl each primer (final 0.2 µM), and about 1 µl fluorescence probe (final 0.1 ~ 0.5 µM), 2 µl DNA template in a final total volume of 25 µl supplemented with ultrapure water. All reaction was performed as the suggestion by manufacturer, including 1 cycle of 95 °C for 30 sec, 40 repeated cycles of 95 °C for 5sec and 60 °C for 30 sec, by using CFX96 real-time PCR machine (Bio-Rad, USA).

Table 1

Primers and probes for Plasmodium species detection.
Method	Species	Primer	Sequence (5’-3’)	Length (bp)	Reference
Nested PCR	Plasmodium sp.	rPLU1	TCAAAGATTAAGCCATGCAAGTGA	1670	[40]
	Plasmodium sp.	rPLU5	CCTGTTGTTGCCTTAAACTTC	1670
	P. falciparum	rFAL1	TTAAACTGGTTTGGGAAAACCAAATATATT	205
	P. falciparum	rFAL2	ACACAATGAACTCAATCATGACTACCCGTC	205
	P. vivax	rPVIV1	CGCTTCTAGCTTAATCCACATAACTGATAC	121
	P. vivax	rPVIV2	ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA	121
	P. malariae	rMAL1	ATAACATAGTTGTACGTTAAGAATAACCGC	145
	P. malariae	rMAL2	AAAATTCCCATGCATAAAAAATTATACAAA	145
	P. ovale	rOVA1WC	TGTAGTATTCAAACGCAGT	659–662
	P. ovale	rOVA2WC	TATGTACTTGTTAAGCCTTT	659–662
	P. ovale curtisi	rOVA1	ATCTCTTTTGCTATTTTTTAGTATTGGAGA	800	[41]
	P. ovale curtisi	rOVA2	GGAAAAGGACACATTAATTGTATCCTAGTG	800
	P. ovale wallikeri	rOVA1v	ATCTCCTTTACTTTTTGTACTGGAGA	780
	P. ovale wallikeri	rOVA2v	GGAAAAGGACACTATAATGTATCCTAATA	780
Real-time PCR	Plasmodium sp.	Plasmo 1	GTTAAGGGAGTGAAGACGATCAGA		[32]
	Plasmodium sp.	Plasmo 2	AACCCAAAGACTTTGATTTCTCATAA
	P. falciparum	P. fal-probe	FAM-AGCAATCTAAAAGTCACCTCGAAAGATGACT-TAMRA
	P. vivax	P. v-probe	HEX-AGCAATCTAAGAATAAACTCCGAAGAGAAAATTCT-TAMRA
	P. malariae	P. m-probe	FAM-CTATCTAAAAGAAACACTCAT-MGB
	P. ovale	P. o-probe	HEX-CGAAAGGAATTTTCTTATT-MGB
	P. ovale	POF	ATAAACTATGCCGACTAGGTT		[39]
	P. ovale	POR	ACTTTGATTTCTCATAAGGTACT
	P. ovale curtisi	POC-probe	FAM-TTCCTTTCGGGGAAATTTCTTAGA-BHQ1
	P. ovale wallikeri	POW-probe	HEX-AATTCCTTTTGGAAATTTCTTAGATTG-BHQ1

Nested PCR assay

The above samples were further determined with nested PCR. For nested PCR, the classical primers targeting on Plasmodium 18S small subunit ribosomal RNA (18S ssrRNA) gene were synthesized and used as previously described [40, 41] (primers list in Table 1). The reaction system for the primary round contained 12.5 µl 2 × NovoStar Green PCR Mix (400 µM deoxynucleoside triphosphate [dNTP], 50 U/ml NovoStar Taq DNA polymerase, 4 mM Mg²⁺ and 2 × PCR buffer), 1 µl each primer (rPLU1 and rPLU5 for 18S Plasmodium species, 10 µM) and 1 µl DNA template in a final total volume of 25 µl supplemented with ultrapure water. The amplification was carried out as following conditions: initial denaturation at 95 °C for 3 min, 30 repeated cycles at 95 °C for 30 sec, 55 °C for 1 min, 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. A 1,670 bp PCR product was obtained from each sample after the primary amplification, which was then used as the DNA template for the secondary amplification. The reaction system and condition in the second round were similar with that in the first round with minor modification. Briefly, the annealing temperature was adjusted to 56 °C and the extension time was changed to 30 sec considering the application products were shorter in the second reactions. All the products from secondary amplification were subjected to 1% agarose gel electrophoresis and judged by their stripe sizes. Products of nested PCR were used for sequencing once divergent results occurred among microscopy and two molecular methods.

Data analysis

To calculate the diagnostic sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and disease prevalence (DP) of four Plasmodium species, results from nested PCR were considered as the standard. Above parameters and 95% confidence interval (95% CI) were obtained from online calculator named vassarstats [42]. Flowchart and patients distribution map were drown in Microsoft Office Visio 2010. Other figures were finished in Graphpad Prism 5.0. The trend analysis was carried out by curve estimation in linear regression analysis of SPSS 17.0.

Microscopy and RDT detection

Total 296 blood samples from malaria suspected patients were collected (Fig. 1). By using microscopy and RDT, 288 positive samples including 243 P. falciparum, 17 P. vivax, 21 P. ovale, 6 P. malariae and 1 coinfection (P. falciparum + P. ovale) were observed. Seven out of the remaining 8 cases (296 minus 288) were microscopy negative but RDT positive (Fig. 1). The last case involved was both microscopy and RDT negative, a suspected patient with clinical symptoms of malaria.

For the 243 microscopy positive P. falciparum cases (Fig. 2A), parasitaemia ranged from 100 to 500,000 parasite/µl and the mean parasite density was 88,879 parasite/µl (95% CI = 71,794 − 105,963). These cases were divided into six groups according to their densities: Very Low (≤ 100 parasite/µl), Low (101–500 parasite/µl), Low-middle (501-3,000 parasite/µl), Middle (3,001–10,000 parasite/µl), Middle-high (10,001-100,000 parasite/µl) and High (> 100,000 parasite/µl). From the very low group to the high group (see Fig. 2B and Table 2), case numbers of P. falciparum for each density interval were 7 (2.88%), 26 (10.70%), 34 (33 + 1, 13.99%), 30 (12.35%), 96 (39.51%) and 50 (20.58%), respectively. For P. vivax, parasitaemia ranged from 100 to 30,000 parasite/µl and the mean parasite density was 4,600 parasite/µl (95% CI = 989-8,211). For P. ovale, parasitaemia ranged from 500 to 10,000 parasite/µl and the mean parasite density was 2,610 parasite/µl (95% CI = 1,348-3,871). Of which, 23.53% (4/17) of P. vivax and 19.05% (4/21) of P. ovale had parasite densities ≤ 500 parasite/µl. All the 6 P. malariae cases had parasite densities from 800 to 4,000 parasite/µl and the one mixed infection was 50,000 parasite/µl (see Fig. 2A).

Table 2

Determination of Plasmodium species by microcopic examination and molecular diagnosis.
Microcopic	Parasitemia (No. of parasites /µl)				Nested PCR ^a		Real-time PCR
Microcopic	Species		Intensity (parasite/ul)	No.	Species	No.	Species	No.
Microcopy positive	P. falciparum	Very Low (≤ 100)		7	Pf	6	Pf	5
		Low (101–500)		26	Pf	25	Pf	21
		Low-middle (501-3,000)		33	Pf	32	Pf	32
		Middle (3,001–10,000)		30	Pf	30	Pf	30
		Middle-high (10,001-100,000)		96	Pf	96	Pf	96
		High (> 100,000)		50	Pf	50	Pf	50
		Error correction (3,000)		1	Pf + Po	1	Pf + Po	1
	P. vivax	From 100 to 10,000		15	Pv	15	Pv	15
	P. vivax	Error correction		2	Pv + Po	2	Pv + Po	2
	P. ovale	From 100 to 10,000		19	Po	19	Po	21
	P. ovale	Error correction		2	Pf ^a +Po	2	Pf + Po	0
	P. malariae	From 100 to 10,000		6	Pm	6	Pm	6
	P. falciparum + P. ovale	50,000		1	Po	1	Po	1
Microcopy negative	P. falciparum^b			7	Pf	5	Pf	3
Microcopy negative	Suspected case			1	Pf	1	Pf	1
Total				296		291		284
a,The nested PCR products of these cases have been confirmed by DNA sequencing. b, These cases were RDT positive for Pf.

Confirmation of parasite species with PCR based methods

These samples were confirmed via both nested PCR and real-time PCR. After reconfirmation by nested PCR (Primers were shown in Table 1), 1.04% (3/288) microscopy positive and 25% (2/8) microscopy negative cases failed to be detected out. While 2.78% (8/288) microscopy positive and 50% (4/8) microscopy negative subjects showed negative by real-time PCR (Fig. 1). Nested PCR products of the 7 cases (12 minus 5), which were P. falciparum positive by nested PCR but negative by real-time PCR, were sequenced and results proved they were all P. falciparum infection. As shown in Table 2, the total 5 negative cases by nested PCR were either distributed in the three groups with relative low P. falciparum density (Very low, Low, Low-middle) or in microscopy negative group. For the total 12 cases failed to be detected by real-time PCR, they were all related to P. falciparum. Their parasite density distributions were highly accordance with that in nested PCR detection, including 2 cases in Very low group, 5 cases in Low group, 1 case in Low-middle group and 4 cases in microscopy negative group. Additionally, both two molecular tools revealed one P. falciparum plus P. ovalis mixed infection case among the microscopy positive P. falciparum samples. And the one suspected case negative by both microscopy and RDT was proved to be P. falciparum infection.

Of the 17 microscopy positive P. vivax cases, two actually were proved to be P. vivax plus P. ovalis mixed infection by both nested and real-time PCR. All the 21 microscopy positive P. ovalis cases were diagnosed as positive by real-time PCR, but actually, two of them were proved to be P. falciparum plus P. ovalis mixed infection by nested PCR and followed sequencing. Identification of 6 P. malariae cases showed the same results by three methods. There was also a case that was diagnosed as P. falciparum plus P. ovalis infection by microscopy. However, both nested PCR and real-time PCR only revealed the existence of P. ovalis but not P. falciparum (Table 2). Subspecies identification of the total 20 single P. ovalis positive cases showed that they were consist of 10 P. ovale curtisi, 9 P. ovale wallikeri and 1 mixture of the two subspecies according to nested PCR and sequencing. Real-time PCR revealed the similar results except for 3 P. ovale curtisi negative cases (data not shown).

Diagnostic profile of Plasmodium species by different methods

As showed in Fig. 1 and Table 3, amongst the 296 samples involved, there were 243 (82.09%) P. falciparum, 17 (5.74%) P. vivax, 21 (7.09%) P. ovalis, 6 (2.03%) P. malariae, 1 (0.34%) mixted infection (P. falciparum + P. ovalis) and 8 (2.70%) negative cases according to microscopic observation. Based on the nested PCR, 245 (82.77%), 15 (5.07%), 20 (6.76%) and 6 (2.03%) cases were identified as single infection of P. falciparum, P. vivax, P. ovalis and P. malariae, respectively, whereas dual species mixed infections included 3 (1.01%) cases of P. falciparum + P. ovalis, 2 (0.68%) cases of P. vivax + P. ovalis and 5 (1.69%) negative cases. Real-time PCR revealed small different results, including 238 (80.41%) P. falciparum, 15 (5.07%) P. vivax, 22 (7.43%) P. ovalis, 6 (2.03%) P. malariae, 1 (0.34%) mixed infections of P. falciparum + P. ovalis, 2 (0.68%) cases of P. vivax + P. ovalis and 12 (4.05%) negative cases. No triple even quadruple infection was detected in these samples.

Table 3

Comparison analysis of diagnostic tools for imported Plasmodium species infection in Wuhan, China.

Microscopy	Species	P. falciparum	P. vivax	P. ovale	P. malariae	P. falciparum + P. ovale	P. vivax + P. ovale	Negative	Total (%)
	P. falciparum	239	0	0	0	1	0	3	243 (82.09)
	P. vivax	0	15	0	0	0	2	0	17 (5.74)
	P. ovale	0	0	19	0	2	0	0	21 (7.09)
	P. malariae	0	0	0	6	0	0	0	6 (2.03)
	P. falciparum + P. ovale	0	0	1	0	0	0	0	1 (0.34)
	Negative ^a	6	0	0	0	0	0	2	8 (2.70 )
	Total	245 (82.77)	15 (5.07)	20 (6.76)	6 (2.03)	3 (1.01)	2 (0.68)	5 (1.69)	296 (100.00)
Real-time PCR	P. falciparum	238	0	0	0	0	0	0	238 (80.41)
	P. vivax	0	15	0	0	0	0	0	15 (5.07)
	P. ovale	0	0	20	0	2	0	0	22 (7.43)
	P. malariae	0	0	0	6	0	0	0	6 (2.03)
	P. falciparum + P. ovale	0	0	0	0	1	0	0	1 ( 0.34)
	P. vivax + P. ovale	0	0	0	0	0	2	0	2 (0.68)
	Negative	7	0	0	0	0	0	5	12 (4.05)
	Total	245 (82.77)	15 (5.07)	20 (6.76)	6 (2.03)	3 (1.01)	2 (0.68)	5 (1.69)	296 (100.00)
a, these included 7 RDT positive and 1 RDT negative but suspected cases

Diagnostic performance of microscopy and real-time PCR compared to nested PCR

Nested PCR was appointed as a reference for the diagnostic summarizing of Plasmodium species as well as the following performance assessment about the diagnostic methods. As shown in Table 4, for microscopy, the sensitivity in identification of P. falciparum, P. vivax, P. ovalis and P. malariae were 96.77%, 100%, 88.00% and 100.00%, respectively. Specificity for P. falciparum diagnosis was 91.67% and all 100.00% for other three species. The probabilities of identification for P. falciparum, P. vivax, P. ovalis and P. malariae by microscopy from the predicted positive (PPV) and not identification from predictive negative (NPV) samples were 98.36% and 84.62% (P. falciparum), 100.00% and 100.00% (P. vivax), 100.00% and 98.91% (P. ovalis), 100.00% and 100.00% (P. malariae), respectively. For the detection of P. falciparum by real-time PCR, sensitivity, specificity, PPV and NPV were 96.37%, 100%, 100% and 84.21%, respectively. These four assessment indexes were all 100% in the other three species diagnosis by using real-time PCR.

Table 4

Performance of microscopy and real-time PCR compared to the reference nested PCR, including sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and disease prevalence (DP).
Nested PCR ™ as standard (Confirmed by sequencing)
Methodological evaluation		Plasmodium species
Methodological evaluation		P. falciparum		P. vivax		P. ovale		P. malariae
Nested PCR VS Microscopy	Parameters	Positive	Negative	Positive	Negative	Positive	Negative	Positive	Negative
	Positive	240	4	17	0	22	0	6	0
	Negative	8	44	0	279	3	271	0	290
	Analyze	Percentage (95% CI)		Percentage (95% CI)		Percentage (95% CI)		Percentage (95% CI)
	Sensitivity	96.77 (93.51–98.49)		100.00 (77.08–100.00)		88.00 (67.66–96.85)		100.00 (51.68–100.00)
	Specificity	91.67 (79.13–97.30)		100.00 (98.31–100.00)		100.00 (98.26–100.00)		100.00 (98.37–100.00)
	PPV	98.36 (95.58–99.47)		100.00 (77.08–100.00)		100.00 (81.50–100.00)		100.00 (51.68–100.00)
	NPV	84.62 (71.37–92.66)		100.00 (98.31–100.00)		98.91 (96.57–99.72)		100.00 (98.37–100.00)
	DP	83.78 (78.97–87.69)		5.74 (3.49–9.21)		8.45 (5.65–12.36)		2.03 (0.83–4.58)
Nested PCR VS Real Time PCR	Parameters	Positive	Negative	Positive	Negative	Positive	Negative	Positive	Negative
	Positive	239	0	17	0	25	0	6	0
	Negative	9	48	0	279	0	271	0	290
	Analyze	Percentage (95% CI)		Percentage (95% CI)		Percentage (95% CI)		Percentage (95% CI)
	Sensitivity	96.37 (92.99–98.22)		100.00 (77.08–100.00)		100.00 (83.42–100.00)		100.00 (51.68–100.00)
	Specificity	100 (90.77–100)		100.00 (98.31–100.00)		100.00 (98.26–100.00)		100.00 (98.37–100.00)
	PPV	100 (98.03–100)		100.00 (77.08–100.00)		100.00 (83.42–100.00)		100.00 (51.68–100.00)
	NPV	84.21 (71.63–92.09)		100.00 (98.31–100.00)		100.00 (98.26–100.00)		100.00 (98.37–100.00)
	DP	83.78 (78.97–87.69)		5.74 (3.49–9.21)		8.45 (5.65–12.36)		2.03 (0.83–4.58)

The results also revealed that P. falciparum (83.78%) infection was the most prevalent, followed by P. ovalis (8.45%), P. vivax (5.74%) and P. malariae (2.03%) among the imported malaria cases in Wuhan, China. Due to RDT could only distinguish falciparum and non-falciparum Plasmodium species infection, RDT was not involved in methodological evaluation for these samples.

Origin and years distribution of patients

Tracing the origin of imported malaria patients demonstrated the patients returned from 28 countries of Africa and 4 countries of Asia (Fig. 3A). Of the total 291 patients confirmed by nested PCR, 112 (38.49%) malaria patients infected from West Africa, followed by Central Africa (66 cases, 22.68%), Southern Africa (62 cases, 21.31%), East Africa (38 cases, 13.06%), SEA (9 cases, 3.09%) and South Asia (4 cases, 1.37%) (Fig. 3B). Distribution of malaria patients caused by P. falciparum was highly accordance with above general tendency, including 102 cases from West Africa, 55 from Central Africa, 55 from Southern Africa, 27 from East Africa and 6 from SEA. Amongst the P. vivax patients, 8 returned from East Africa. The remainders all returned from SEA (3 cases) and South Asia (4 cases), respectively. The P. ovalis patients returned from West Africa (10/20), Central Africa (8/20) and Southern Africa (2/20). Only 6 P. malariae infected patients were involved, three returned from Southern Africa, two from Central Africa and one from East Africa. The five mixed infection patients also returned from the three regions as P. malariae infection group.

From 2011 to 2016 (Fig. 3B), the imported malaria patients have roughly gradually increased yearly. Luckily, only 20 imported malaria patients reported from the CDC and hospitals of Wuhan in 2017. However, clinical malaria patients in 2018 rose again and reached up to 44 cases. It is note that the predominant species was P. falciparum during the surveyed period. However, it is worth mentioning no considerably increasing trends in the prevalence of P. falciparum parasites infection (F = 0.078, P = 0.790) was detected yearly. Other Plasmodium species including P. vivax, P. ovalis and P. malariae single infection or mixed infection hadn’t been found until 2014. In the next five years (2014–2018), patients infected with P. vivax (15 cases), P. ovalis (20 cases), P. malariae (6 cases) and mixed parasite species (5 cases) were accepted.

In 2020, China hopes that national malaria elimination will become a real possibility based on effective control measures [4]. Although no indigenous malaria case has been reported in China since 2017, the imported malaria is becoming a serious obstacle for malaria elimination. If China plans to achieve the stated goals on schedule, continuous surveillance of the imported malaria is an essential measure. As an important city of Central China, Wuhan has a population of 11.08 million. Meanwhile, it faces similar problems: The imported malaria cases increased annually accompanied by the disappearance of indigenous malaria cases since 2013 [5]. Thus, it is very necessary to monitor the epidemic status of imported malaria in China including Wuhan. Furthermore, identification of the malaria parasite species with timely and effective method could provide valuable information for developing suitable clinical treatment.

In current study, of the 243 P. falciparum cases identified by microscopy, one case actually was proved to be infected with P. falciparum plus P. ovalis later by both molecular tests. Two microscopy positive P. vivax cases were also proved to actually infect with P. vivax plus P. ovalis. Likewise, two patients with single P. ovalis infection by microscopy were proved as P. ovalis plus P. falciparum infection by nested PCR. In the previous studies, P. ovale was also frequently reported involved in mixed infection with other Plasmodium species [17, 43, 44]. These results proved the limitation of microscopy in identification of mixed infection and the highly specialized requirement for observers [45]. The identification of P. ovale curtisi and P. ovale wallikeri in total 20 single P. ovalis infection cases, which were failed to be distinguished by microscopy, also evidenced the advantages of molecular tools in species identification. Their diagnosis will offer a clue for the precise treatment of malaria patients. Subsequently, nested PCR also proved 6 cases as P. falciparum infection, which were consist of 5 microscopy negative but RDT positive cases and even one double-negative case. This was probably because parasitaemia was too low to be observed for these cases. As reported previous studies [46, 47], microscopy has a sensitivity of 50 ~ 500 parasites/µl in Plasmodium detection, but the threshold, 50 parasites/µl was rarely obtained unless under optimum conditions. This means that, it is actually difficult for observer to accurately find out the species with relative low parasitemia, especially in mixed infection.

In the analysis of sensitivity, specificity, PPV and NPV, nested PCR-based detection was chosen as the reference standard. Actually, nested PCR was commonly selected as a reference method [48, 49]. By comparing to nested PCR, microscopy (96.77%) showed highly similar sensitivity with real-time PCR (96.37%) in P. falciparum identification. However, the specificity of microscopy was only 91.67%, lower than the 100% in rea1-time PCR detection. By designing complementary probe to target gene sequence, Taqman probe is another guarantee besides primers to enhance the specificity and avoid the false positive results [35]. The NPV for P. falciparum detection was about 85% in both microscopy and real-time PCR detection, indicating relative high false negative rate about 15% appeared in these two methods. A false negative rate as high as 19.4% for microscopy assay was reported in other study [50], indicating the persistent limitation of microscopy. For P. ovalis, the sensitivity (88.00%) in microscopic identification was relative low and NPV for P. ovalis was 98.91%. Two of the 3 P. ovalis cases that failed to be detected out by microscopy were involved in P. ovalis plus P. vivax mixed infection. This may due to the similar morphology between P. ovale with P. vivax [10], as a result, the species with relative lower parasitemia may be hidden. Four indexes (Table 4) in real-time PCR detection were all 100% in P. vivax, P. malariae and P. ovalis detection, revealing the high consistency between two molecular tools in these three species identification. P. malariae could be accurately diagnosed by all the three methods. This may be attributed by only 6 P. malariae cases were involved in the study. The primers of real-time PCR used in this study have been used in several previous studies [32, 51]. But it is reported that different templates amplification simultaneous was difficult and the primers preferred to amplify species with higher parasitemia as result of competition for the shared primers (Plasmo1 and Plasmo2). In present data, 7 cases out of the total 9 nested PCR positive patients failed to be identified by real-time PCR. Actually, all had low parasitemia and the remained two were involved in mixed infection. Similar phenomena also reported in previous studies [52, 53]. As we know, false negative result means a person with Plasmodium infection failed to be diagnosed. This could cause misdiagnosis, delay treatment of malaria and even lead to a life-threatening problem, especially for P. falciparum infection. Beyond the individual damage, false negative patients may also spread malaria and produce resistance to antimalarial drugs without correct treatment guided by exact diagnosis [50].

Although nested PCR showed the highest sensitivity and real-time PCR has the best specificity, the role of microscopy and RDT is still not substituted. Because conduct of the two molecular methods is relied on DNA extraction of blood samples. Once errors happened during this program, the false negative would probably present. For example, in a previous study, there were 10 malaria cases failed to be identified by molecular methods due to the problems in nucleic acid extraction until reasons were found out by repeated experiments [54]. Therefore, the combining use of the four methods is quite necessary and highly recommended. Both microscopy and RDT can offer the preliminary result and suggest further diagnostic direction. Based on the valuable information, the Plasmodium species can be confirmed by molecular methods easily including nested PCR and real-time PCR.

The origin of patients was basically consistent with a previous report referring to epidemiologic features of imported malaria in the whole China [55]. In these epidemic regions of Africa and SEA, the natural environment, healthcare and situation of economic development may be primary influences on malaria infection. Chinese people overseas especially those didn’t long-term inhabit in epidemic areas usually lacked adaptive immunity and related awareness to local Plasmodium infection [55]. Additionally, there were frequently asymptomatic patients existing [56]. These remind us that workers returned from these areas particularly West Africa, Central Africa, and Southern Africa should be recommended to accept malaria diagnosis. As the dominating malaria species, P. falciparum was similar to other study [50]. Therefore, prevention and treatment against P. falciparum should be highly considered in Wuhan. By the year elapsed, the Plasmodium species leading to imported malaria were becoming diversity just as the situation in another region of China, Shandong province [54]. The increase of imported P. vivax and P. ovalis cases may cause the re-introduction of malaria in those regions without cases [57, 58]. P. malariae could maintain in human for many years and keep infectivity to its vector at a really low parasitemia [59]. Thus, more attention should be payed on this increasing diversity. The sharp decrease of imported malaria cases in 2017 was a good sign indicating the performance of malaria control. However, the cases raised again in 2018, warning us the great challenging for complete elimination of Plasmodium infection worldwide, even in China.

Results in this study could assess the efficiency of 18S ssrRNA based nested PCR and real-time PCR in the differentiation of four Plasmodium species and two subspecies of P. ovalis. The results highlighted, once again, that PCR based detections are irreplaceable methods for exact species determination of imported malaria patients, especially for mixed infections. We also emphasized the combination use of the four methods involved in the present study. Meanwhile, the data as a very important epidemiological resource, could supply guidance for the surveillance, prevention and timely treatment of imported malaria in Wuhan of China. The guiding effect is also significant to the epidemic areas as shown in the origin distribution survey or even to countries at potential high risk of imported malaria worldwide.

Pf: P. falciparum; Pv: P. vivax; Pm: P. malariae; Po: P. ovalis; Poc: P. ovale curtisi; Pow: P. ovale wallikeri; RDT: rapid diagnosis test; PPV: Positive Predictive value; NPV: Negative Predictive value; DP: disease prevalence; CDC: Center for Disease Prevention and Control.

Acknowledgements

The authors thank all the participants who contributed their blood samples, laboratorian, clinician, nurses, and everyone who supported this study directly or indirectly.

Authors’ contributions

J. L. and K. W. conceived the study, and participated in its design and coordination. K.W., MX. X., and Y. Y. carried out sample collection. YT. X. and J. L. interpreted the data and wrote the manuscript. YT. X., TT. J. and Y.Y. carried out molecular assays and performed statistical analysis. YT. X., TT. J., K.W. and HB. T. participated in molecular assays and data analysis. YT. X. and J. L. reviewed the final manuscript. All authors read and approved the final version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (J.L. Grant Number 81802046), Foundation for Innovative Research Team of Hubei University of Medicine (J.L. Grant Number FDFR201603), and Health Commission of Hubei Province Scientific Research Project (YT.X. Grant Number WJ2019Q012). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials
The datasets analyzed in this study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate
Current study was approved by the Medical Ethics Committees of the Hubei University of Medicine and Wuhan City Center for Disease Prevention and Control. The written informed consent was obtained from all participated individuals.

Consent for publication
Not applicable.

Competing interests

The authors declare that they have no competing interests.

WHO. World malaria report 2018. Geneva: World Health Organization; 2018. Licence: CC BY-NC-SA. 2018;3.
WHO. Global technical strategy for malaria 2016-2030. World Health Organization; 2015.
Xia ZG, Wang RB, Wang DQ, Feng J, Zheng Q, Deng CS, et al. China-Africa cooperation initiatives in malaria control and elimination. Adv Parasitol. 2014;86:319-37.
Feng J, Zhang L, Huang F, Yin JH, Tu H, Xia ZG, et al. Ready for malaria elimination: zero indigenous case reported in the People's Republic of China. Malar J. 2018;17 1:315.
Xia J, Huang X, Sun L, Zhu H, Lin W, Dong X, et al. Epidemiological characteristics of malaria from control to elimination in Hubei Province, China, 2005-2016. Malar J. 2018;17 1:81.
Phillips RS. Current status of malaria and potential for control. Clin Microbiol Rev. 2001;14 1:208-26.
Mueller I, Galinski MR, Baird JK, Carlton JM, Kochar DK, Alonso PL, et al. Key gaps in the knowledge of Plasmodium vivax, a neglected human malaria parasite. Lancet Infect Dis. 2009;9 9:555-66.
Gething PW, Elyazar IR, Moyes CL, Smith DL, Battle KE, Guerra CA, et al. A long neglected world malaria map: Plasmodium vivax endemicity in 2010. PLoS Negl Trop Dis. 2012;6 9:e1814.
de Laval F, Simon F, Bogreau H, Rapp C, Wurtz N, Oliver M, et al. Emergence of Plasmodium ovale malaria among the French Armed Forces in the Republic of Ivory Coast: 20 years of clinical and biological experience. Clin Infect Dis. 2014;58 8:e122-8.
Miller RH, Obuya CO, Wanja EW, Ogutu B, Waitumbi J, Luckhart S, et al. Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya utilizing a novel species-specific real-time PCR assay. PLoS Negl Trop Dis. 2015;9 1:e0003469.
Sutherland CJ, Tanomsing N, Nolder D, Oguike M, Jennison C, Pukrittayakamee S, et al. Two nonrecombining sympatric forms of the human malaria parasite Plasmodium ovale occur globally. J Infect Dis. 2010;201 10:1544-50.
Nolder D, Oguike MC, Maxwell-Scott H, Niyazi HA, Smith V, Chiodini PL, et al. An observational study of malaria in British travellers: Plasmodium ovale wallikeri and Plasmodium ovale curtisi differ significantly in the duration of latency. BMJ Open. 2013;3 5.
Zhou R, Li S, Zhao Y, Yang C, Liu Y, Qian D, et al. Characterization of Plasmodium ovale spp. imported from Africa to Henan Province, China. Sci Rep. 2019;9 1:2191.
Phillips MA, Burrows JN, Manyando C, van Huijsduijnen RH, Van Voorhis WC, Wells TNC. Malaria. Nat Rev Dis Primers. 2017;3:17050.
Cox-Singh J. Zoonotic malaria: Plasmodium knowlesi, an emerging pathogen. Curr Opin Infect Dis. 2012;25 5:530-6.
Zimmerman PA, Mehlotra RK, Kasehagen LJ, Kazura JW. Why do we need to know more about mixed Plasmodium species infections in humans? Trends Parasitol. 2004;20 9:440-7.
Mueller I, Zimmerman PA, Reeder JC. Plasmodium malariae and Plasmodium ovale--the "bashful" malaria parasites. Trends Parasitol. 2007;23 6:278-83.
Baird JK. Evidence and implications of mortality associated with acute Plasmodium vivax malaria. Clin Microbiol Rev. 2013;26 1:36-57.
Bichara C, Flahaut P, Costa D, Bienvenu AL, Picot S, Gargala G. Cryptic Plasmodium ovale concurrent with mixed Plasmodium falciparum and Plasmodium malariae infection in two children from Central African Republic. Malar J. 2017;16 1:339.
Kyabayinze DJ, Tibenderana JK, Odong GW, Rwakimari JB, Counihan H. Operational accuracy and comparative persistent antigenicity of HRP2 rapid diagnostic tests for Plasmodium falciparum malaria in a hyperendemic region of Uganda. Malar J. 2008;7:221.
Chanie M, Erko B, Animut A, Legesse M. Performance of CareStart™ malaria Pf/Pv combo test for the diagnosis of Plasmodium falciparum and Plasmodium vivax infections in the afar region, North East Ethiopia. Ethiopian Journal of Health Development. 2011;25 3:206-11.
Payne D. Use and limitations of light microscopy for diagnosing malaria at the primary health care level. Bull World Health Organ. 1988;66 5:621-6.
Ohrt C, Purnomo, Sutamihardja MA, Tang D, Kain KC. Impact of microscopy error on estimates of protective efficacy in malaria-prevention trials. J Infect Dis. 2002;186 4:540-6.
Hanscheid T. Current strategies to avoid misdiagnosis of malaria. Clin Microbiol Infect. 2003;9 6:497-504.
Dhiman S, Goswami D, Kumar D, Rabha B, Sharma DK, Bhola RK, et al. Nested PCR detection of Plasmodium malariae from microscopy confirmed P. falciparum samples in endemic area of NE India. Folia Parasitol (Praha). 2013;60 5:401-5.
Krishna S, Bharti PK, Chandel HS, Ahmad A, Kumar R, Singh PP, et al. Detection of Mixed Infections with Plasmodium spp. by PCR, India, 2014. Emerg Infect Dis. 2015;21 10:1853-7.
Lau YL, Lai MY, Anthony CN, Chang PY, Palaeya V, Fong MY, et al. Comparison of three molecular methods for the detection and speciation of five human Plasmodium species. Am J Trop Med Hyg. 2015;92 1:28-33.
Dimaio MA, Pereira IT, George TI, Banaei N. Performance of BinaxNOW for diagnosis of malaria in a U.S. hospital. J Clin Microbiol. 2012;50 9:2877-80.
Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS One. 2010;5 1:e8091.
Deme AB, Park DJ, Bei AK, Sarr O, Badiane AS, Gueye Pel H, et al. Analysis of pfhrp2 genetic diversity in Senegal and implications for use of rapid diagnostic tests. Malar J. 2014;13:34.
Parr JB, Belson C, Patel JC, Hoffman IF, Kamthunzi P, Martinson F, et al. Estimation of Plasmodium falciparum Transmission Intensity in Lilongwe, Malawi, by Microscopy, Rapid Diagnostic Testing, and Nucleic Acid Detection. Am J Trop Med Hyg. 2016;95 2:373-7.
Rougemont M, Van Saanen M, Sahli R, Hinrikson HP, Bille J, Jaton K. Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays. J Clin Microbiol. 2004;42 12:5636-43.
Wang B, Han SS, Cho C, Han JH, Cheng Y, Lee SK, et al. Comparison of microscopy, nested-PCR, and Real-Time-PCR assays using high-throughput screening of pooled samples for diagnosis of malaria in asymptomatic carriers from areas of endemicity in Myanmar. J Clin Microbiol. 2014;52 6:1838-45.
Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, et al. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004;364 9432:438-47.
Smith CJ, Osborn AM. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 2009;67 1:6-20.
Bailey JW, Williams J, Bain BJ, Parker-Williams J, Chiodini PL. Guideline: the laboratory diagnosis of malaria. General Haematology Task Force of the British Committee for Standards in Haematology. Br J Haematol. 2013;163 5:573-80.
Yao Y, Wu K, Xu M, Yang Y, Zhang Y, Yang W, et al. Surveillance of Genetic Variations Associated with Antimalarial Resistance of Plasmodium falciparum Isolates from Returned Migrant Workers in Wuhan, Central China. Antimicrob Agents Chemother. 2018;62 9.
Wanja EW, Kuya N, Moranga C, Hickman M, Johnson JD, Moseti C, et al. Field evaluation of diagnostic performance of malaria rapid diagnostic tests in western Kenya. Malar J. 2016;15:456.
Bauffe F, Desplans J, Fraisier C, Parzy D. Real-time PCR assay for discrimination of Plasmodium ovale curtisi and Plasmodium ovale wallikeri in the Ivory Coast and in the Comoros Islands. Malar J. 2012;11:307.
Snounou G, Singh B. Nested PCR analysis of Plasmodium parasites. Methods Mol Med. 2002;72:189-203.
Fuehrer HP SMT, Buczolich K, Bloeschl I, & Noedl H. Two techniques for simultaneous identification of Plasmodium ovale curtisi and Plasmodium ovale wallikeri by use of the small-subunit rRNA gene. J Clin Microbiol. 2012;50:4100–2.
Kim JY, Ji SY, Goo YK, Na BK, Pyo HJ, Lee HN, et al. Comparison of rapid diagnostic tests for the detection of Plasmodium vivax malaria in South Korea. PLoS One. 2013;8 5:e64353.
Dinko B, Oguike MC, Larbi JA, Bousema T, Sutherland CJ. Persistent detection of Plasmodium falciparum, P. malariae, P. ovale curtisi and P. ovale wallikeri after ACT treatment of asymptomatic Ghanaian school-children. Int J Parasitol Drugs Drug Resist. 2013;3:45-50.
Betson M, Sousa-Figueiredo JC, Atuhaire A, Arinaitwe M, Adriko M, Mwesigwa G, et al. Detection of persistent Plasmodium spp. infections in Ugandan children after artemether-lumefantrine treatment. Parasitology. 2014;141 14:1880-90.
Mekonnen SK, Aseffa A, Medhin G, Berhe N, Velavan TP. Re-evaluation of microscopy confirmed Plasmodium falciparum and Plasmodium vivax malaria by nested PCR detection in southern Ethiopia. Malar J. 2014;13:48.
Guerin PJ, Olliaro P, Nosten F, Druilhe P, Laxminarayan R, Binka F, et al. Malaria: current status of control, diagnosis, treatment, and a proposed agenda for research and development. Lancet Infect Dis. 2002;2 9:564-73.
Moody A. Rapid diagnostic tests for malaria parasites. Clin Microbiol Rev. 2002;15 1:66-78.
Bourgeois N, Boutet A, Bousquet PJ, Basset D, Douard-Enault C, Charachon S, et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clin Microbiol Infect. 2010;16 8:1305-11.
Alemu A, Fuehrer HP, Getnet G, Kassu A, Getie S, Noedl H. Comparison of Giemsa microscopy with nested PCR for the diagnosis of malaria in North Gondar, north-west Ethiopia. Malar J. 2014;13:174.
Berzosa P, de Lucio A, Romay-Barja M, Herrador Z, Gonzalez V, Garcia L, et al. Comparison of three diagnostic methods (microscopy, RDT, and PCR) for the detection of malaria parasites in representative samples from Equatorial Guinea. Malar J. 2018;17 1:333.
Shokoples SE, Ndao M, Kowalewska-Grochowska K, Yanow SK. Multiplexed real-time PCR assay for discrimination of Plasmodium species with improved sensitivity for mixed infections. J Clin Microbiol. 2009;47 4:975-80.
McKenzie FE, Sirichaisinthop J, Miller RS, Gasser RA, Jr., Wongsrichanalai C. Dependence of malaria detection and species diagnosis by microscopy on parasite density. Am J Trop Med Hyg. 2003;69 4:372-6.
Nankabirwa J, Zurovac D, Njogu JN, Rwakimari JB, Counihan H, Snow RW, et al. Malaria misdiagnosis in Uganda--implications for policy change. Malar J. 2009;8:66.
Xu C, Wei QK, Li J, Xiao T, Yin K, Zhao CL, et al. Characteristics of Imported Malaria and Species of Plasmodium Involved in Shandong Province, China (2012-2014). Korean J Parasitol. 2016;54 4:407-14.
Li Z, Zhang Q, Zheng C, Zhou S, Sun J, Zhang Z, et al. Epidemiologic features of overseas imported malaria in the People's Republic of China. Malar J. 2016;15:141.
Li Z, Yang Y, Xiao N, Zhou S, Lin K, Wang D, et al. Malaria imported from Ghana by returning gold miners, China, 2013. Emerg Infect Dis. 2015;21 5:864-7.
Sleigh AC, Liu XL, Jackson S, Li P, Shang LY. Resurgence of vivax malaria in Henan Province, China. Bull World Health Organ. 1998;76 3:265-70.
Wang D, Li S, Cheng Z, Xiao N, Cotter C, Hwang J, et al. Transmission Risk from Imported Plasmodium vivax Malaria in the China-Myanmar Border Region. Emerg Infect Dis. 2015;21 10:1861-4.
Mohapatra PK, Prakash A, Bhattacharyya DR, Goswami BK, Ahmed A, Sarmah B, et al. Detection & molecular confirmation of a focus of Plasmodium malariae in Arunachal Pradesh, India. Indian J Med Res. 2008;128 1:52-6.

Download PDF

Journal Publication

published 03 Sep, 2020

Read the published version in Malaria Journal →

Version 1

posted

You are reading this latest preprint version

Molecular epidemiological surveillance of Africa and Asia imported malaria in Wuhan, Central China: comparison of diagnostic tools during 2011–2018

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials and methods

Collection of study specimens

Microscopic examination and RDT assay

Genomic DNA extraction

Taqman probe based Real-time PCR

Nested PCR assay

Data analysis

Results

Microscopy and RDT detection

Confirmation of parasite species with PCR based methods

Diagnostic profile of Plasmodium species by different methods

Diagnostic performance of microscopy and real-time PCR compared to nested PCR

Origin and years distribution of patients

Discussion

Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1