Cell lines
HEK293T cells with stable GFP and mCherry were obtained from the Bassik lab at Stanford [13]. HEK293T wild type cells were obtained from ATCC (CRL-3216). All cells were cultured with DMEM, 10% FBS, penicillin-streptomycin and L-glutamine. For drug selection 2 ng/µl was used for puromycin, 4 ng/µl for blasticidin and 300 µg/ml for zeocin.
Transfection was performed with Lipofectamine 2000 (ThermoFisher) or Lipofectamine CRISPRMAX Cas9 Transfection reagent (ThermoFisher). Electroporation was performed using Neon transfection system (ThermoFisher).
Plasmids for modified CRISPR-X
pGH389_AID*-dCas9-BlastR was obtained from the Bassik lab at Stanford [13]. sgRNAs were cloned in plasmid #234 sgRNA-PuroR (no MS2) (pGH020 with Ef1-puro). The fact the sgRNA plasmid does not have MS2 changes the mutagenesis targeting region location. sgRNAs against GFP were sgGFP10 and sgGFP1 from [13]. Oligonucleotides with overhangs compatible with subsequent ligation were designed and annealed followed by ligation into the digested vector. The sequences for the sgRNAs are listed in Table 1 in Supplementary Material. All plasmid sequences were verified using Sanger sequencing.
Plasmid for monitoring GCPR activity
6xCRE mCherry plasmid in lentiviral backbone was cloned using lentiviral backbone plasmid pGH235 (gRNA-Zeo, from the Bassik lab) with the insert 6xCRE mCherry SV40 late Poly (A). Full plasmid sequences can be found in supplementary material.
Isoproterenol treatment
Cells were seeded and left for 24 hours in regular media. They were starved with media with 0.1% FBS overnight, before the isoproterenol treatment with 1uM stimulation for 24 hours.
Creation of stable cell line with AID*-dCas9
HEK293T and HEK293T GFP/mCherry were infected with virus for pGH389_AID*-dCas9-BlastR plasmid produced by Transomics with 10µ g/ml polybrene. 3 days after infection, cells were selected with blasticidin 4 ng/µl for at least 7 days.
Single cell clones for HEK293T AID*-dCas9
In order to optimize the homogeneity of the cell population in the study, single cell clones were created for dCas9-AID* using Sony Sorter. Clones were tested for Cas9 expression by Western Blot. One million cells were lysed with RIPA buffer + protease inhibitors + DNAseI. Cas9 antibody used was CRISPR CAS9 MAB 7A9 100UG (Epigentek).
Generation of KO cell lines for B2AR
HEK293T were transfected with Synthetic sgRNA AAGAAGGCGCTGCCGTTCCC (Synthego) and TrueCut Cas9 (RNP) (ThermoFisher), using Lipofectamine CRISPRMAX (ThermoFisher). Two days after transfection, genomic DNA was extracted to evaluate the knock-out efficiency for the pool of cells. The amplicon was amplified using oligos AACTCGCACCAGAAGTTGCC and GCACAGCACATCAATGGAAG, sequenced and analyzed using the ICE tool (Synthego). Single cell clones were plated with conditioned media and left to grow for 2 weeks. Genomic DNA was extracted from the single cell clones using QuickExtract DNA Extraction Solution (Lucigen). The same PCR as previously used was done again, using oligos AACTCGCACCAGAAGTTGCC and GCACAGCACATCAATGGAAG, sequenced and analyzed using the ICE tool (Synthego).
Virus production for sgRNAs
Takara (Clonetech) Lenti-X Packaging Single Shots (4th generation) were used following manufacture protocol. Supernatant was collected 48–72 hours post-transfection to infect cells (with 10µ g/ml polybrene). For the timepoints experiment, when concentrated infection is indicated, Lenti-X concentrator (Clonetech) was used to concentrate the virus.
sgRNA library production
sgRNAs were designed on the B2AR coding sequence along with an additional 50 base pairs at both ends of sequence using the CHOPCHOP tool [27]–[29] and the MIT tool [30]. Results were combined taking CHOPCHOP as reference and adding the 12 unique sgRNAs from MIT results. sgRNAs with off-targets with 3 or more mismatches and no BbsI targets (for cloning purposes) were kept. The final list contained 128 sgRNAs along the 1341 bp of the B2AR coding sequence +/- 50 bp (sgRNA list in Table 2, in supplementary Excel file “B2AR library sgRNAs.xlsx”). The 128 sgRNAs conceptually target 248 of the 413 amino acids in the B2AR sequencing (60% of residues). To ensure diversity on the sgRNA infection, 9 million cells in a p10 plate were infected with the virus at low MOI (0.05) to ensure that at least 1000 cells were infected with the same sgRNA.
Generation of mutants
2–3 days after transfection/infection/electroporation of sgRNA, sustained selection with puromycin 2 ng/µl containing media was used for 14 days, unless shorter times are specified.
siRNAs
siRNA ADRB2 - assay ID s1122 (ref. 4427037), Silencer™ Select Negative Control No. 1 siRNA (ref. 4390843) from Thermo Fisher were used at 10 pmol/well in 24-well plate. ON-TARGETplus Human ADRB1 (153) siRNA – SMARTpool (ref L-005425-00-0005), ON-TARGETplus Non-targeting Control Pool (ref. D-001810-10-05) from Dharmacon were used at 50 nM. RNA was extracted 72 h after transfection using RNeasy Plus Mini Kit (Qiagen).
RT-qPCR
Retrotranscription was performed with QuantiTect Rev. Transcription Kit (Qiagen) using 500 ng of RNA. qPCR was performed with the Taqman assay (ThermoFisher). Taqman probes used were: Hs00240532_s1 ADRB2, Hs03003658_s1 ADRB2, Hs02330048_s1 ADRB1, Hs00265096_s1 ADRB1, Hs00609046_m1 ADRB3, Hs02786624_g1 GAPDH, Hs04420632_g1 GAPDH (ThermoFisher).
Flow Cytometry analysis and Sorting
The Fortessa cytometer was used for analysis and a Sony sorter was used for sorting cells. The sample buffer was PBS-CMF + 10 mM HEPES + 0.5% FBS and the Collection media growth media + 25 mM HEPES.
High content imaging
Red fluorescence was measured in a 96-well plate using IncuCyte Zoom (ThermoFisher Scientific).
Genomic extraction and NGS
Genomic DNA was extracted from 0.5-2 million cells using the Quick-DNA micro prep kit (Zymo). The targeted loci were PCR amplified from 50 ng of genomic DNA using the primers shown in Table 3 in Supplementary Materials with Kapa HiFi Hotstart ready mix (Kapa Biosystems). The PCR product was run for quality control in an Agilent TapeStation 4200. The concentration was measured using Qubit dsDNA HS Assay kit (ThermoFisher Scientific). Libraries were prepared using Taqmentation and the Nextera XT kit protocol (Illumina). Libraries were sequenced through NextSeq 500 (Illumina) with paired-end reads of length 76 bp.
Bioinformatic analysis
BCL files from the sequencing were converted to FASTQ format using BCL2FASTQ (Illumina). SamTools was then used for alignment to the amplicon sequence using a quality score of 30. Mutagenesis rate per position in the amplicon was calculated as “reads of non-reference base allele/total reads”. Mutagenesis rate of 1 is the maximum and means all alleles have been edited. We also normalized the mutagenesis values per sample obtaining mutagenesis z-scores per genomic position. We focused on those positions where the difference of z-scores was greater than 2 between the mCherry negative sorted sample compared to presorted sample.