Cell culture
RAW264.7 murine macrophage cells (ATCC, Manassas, Virginia, USA) were cultured between passage 12 and 25 in Dulbecco’s modified Eagle’s medium supplemented with 10% heat-inactivated fetal calf serum and 1% L-glutamine (ThermoFisher Scientific). The macrophages were seeded at 35,000 cells per well in 12-well plates (Falcon) for ELISA experiments or 110,000 cells per well in 6-well plates (Falcon) for cell lysates, upon reaching 80–90 % confluence after 3-day culture. Cells were maintained at 37 °C with 5 % CO2/air atmosphere and the media were changed every other day.
Human Peripheral Blood Mononuclear Cell isolation
Peripheral Blood Mononuclear Cells (PBMC) were extracted from whole blood of anonymous donor and collected by Etablissement Français du Sang of Paris, France.
PBMC were cultured in Roswell Park Memorial Institute medium (ThermoFisher Scientific) with 10% heat-inactivated fetal calf serum, 1 % L-glutamine, 1 % non-essential amino acids, 1 % sodium pyruvate, penicillin (100 IU/ml), and streptomycin (100 µg/ml). Peripheral blood was harvested in EDTA tubes, blood was diluted with PBS 1:1, layered over Histopaque-1077® (Sigma) and centrifuged for 20 min at 400 g at room temperature. Extracted PBMC were washed twice with sterile PBS then centrifuged at 300 g for 5 min and resuspended in complete medium. For experiments, cells were seeded at 300,000 cells per well in 200 µL of medium in 96-well plates (ThermoFisher Scientific).
Cell Treatments
Cells were exposed to 3-oxo-C12:2-HSL (synthesized as previously described15 or DMSO 0.1% as a control for different durations depending on the experiment, in the presence of the lactonase inhibitor 2-hydroxyquinoline (100 µM, Sigma-Aldrich), in order to limit the hydrolysis of the AHL lactone ring, as described previously15,16.
In RAW264.7 cells, inflammation was triggered with LPS (10 ng/mL, Sigma) and IFNγ (10 U/mL, R&Dsystems) for 2h or 6h, depending on the experiments. PBMC were exposed to LPS (10 ng/mL) and AHL for 24 hours. For TAS2R38 inhibition experiments, cells were exposed to TAS2R38 allosteric inhibitor probenecid (1 mM, Sigma) for one hour before adding AHLs and the inflammatory cocktail, without changing the media.
Lactate dehydrogenase release
Release of lactate dehydrogenase into the medium was measured to assess cellular toxicity. LDH concentration was measured using the Cytotoxicity Detection Kit (Roche, Boulogne-Billancourt, France) according to the manufacturer’s instructions. The media were centrifuged 5min at 250 g to remove any cells. 50 µL of reaction mixture was added to 50 µL of media supernatant in 96-well plates. After 10min at room temperature, 25 µL of stop solution was added. Absorbance at 490 nm was determined with a microplate spectrometer (FLUOstar Omega; BMG Labtech). Results are expressed as absorbance arbitrary units.
Enzyme-Linked Immunosorbent Assay
At the end of cell treatment, the medium was centrifuged at 300g for 5min at 4°C. Supernatant was frozen at -80 °C until ELISA assays. TNFα and IL-1β ELISA kits were purchased from R&D systems and performed according to the manufacturer’s instructions. Briefly, plates were coated with a capture antibody and incubated overnight. Wells were blocked using 1% bovine serum albumin-PBS solution (Sigma), then exposed to cell supernatants at room temperature for two hours. Wells were washed and incubated with the detection antibody for an additional two hours. After thorough washing, Streptavidin-HRP solution was added for 20 min. Wells were washed, then incubated with TMB (Biolegend) solution for 20 min and the reaction was stopped using 1M H2SO4. Absorbance was measured by a spectrometer (FLUOstar Omega; BMG Labtech) at 450nm and the absorbance at 540 nm was subtracted.
RNA extraction for RNA sequencing
Cells were treated for 2 hours and then washed once with PBS before RNA extraction using RNeasy minikit (Qiagen), according to the manufacturer’s instructions. Briefly, cells were lysed and 1 volume of ethanol was added. The sample was transferred into a spin column and centrifuged at 8,000 g for 15 sec. The column was washed several times and then eluted with water. RNA quality was assessed using NanoChip (Agilent) on a chip reader (Bioanalyzer 2100, Agilent)
mRNA sequencing
After extraction, total RNA were qualified with the AGILENT tapeStation 2200. Preparation of mRNA libraries was performed according to the manufacturer’s recommendations (KAPA mRNA HyperPrep Kit from ROCHE). Final samples pooled into a library were sequenced on ILLUMINA Novaseq 6000, corresponding to 2x28 Millions of 100 bases reads per sample after demultiplexing.
RNA-Seq data analysis workflow
FastQC v 0.11.953 was used for the quality control of raw paired-end fastq data set. Illumina’s adapters were removed from reads using cutadapt v2.1054. Trim_galore v0.6.455 was used to trim bad quality bases (Phred < 20). Salmon v 1.4.056 was used to quantify paired-end reads against a mapping-based index built from the Ensembl GRCm38 transcript set for all samples. Downstream analysis was handled in R platform v4.0.257 and its add-on packages. Quantified transcripts were imported into R using the package tximport v1.16.158. Gene-level DESeqDataSet object was built from previously imported transcript level abundances using the package DESeq259 to perform the differential expression analysis. A pre-filtering was applied to remove genes with less than 5 counts in one sample. For visualisation, raw counts were transformed using the “variance stabilizing transformation” method implemented in the package DESeq2. For an overview of the variability among samples, Principal Component Analysis was performed on variance stabilizing transformation and normalised count dataset using the package ade4 v 1.7-1660. Differential expression analysis was carried out by the DESeq function of the DESeq2 package. Briefly, the size factor was estimated for each sample, the dispersion was estimated for each gene, counts were fitted to a Negative Binomial Generalized Linear Model and Wald’s test was conducted to test the difference in expression between biological conditions. The Benjamini-Hochberg method61 was used for controlling the False-discovery rate (FDR). Significance level was fixed at type I error alpha = 0.01. Volcano plots were used to display the results of differential analysis using the ggplot2 v3.3.362 package. All significant gene lists were annotated for enriched biological functions and pathways using the DAVID platform through the RDAVIDWebService v1.28.063 package for gene ontology64 and Kyoto Encyclopedia of Genes and Genomes terms65. Significant terms had adjusted p-value, according to the Benjamini-Hochberg method, below 0.05. In addition to the traditional gene by gene analysis, count dataset was analysed at KEGG pathway level using the package Ensemble of Gene Set Enrichment Analysis (EGSEA) v1.16.066 that combines results from twelve algorithms to improve the biological relevance of pathways. Thus, significant pathways had adjusted p-value below 0.01. Gene expression heatmaps were produced by the pheatmap v1.0.1267 package. We used Venn diagrams to globally visualize the overlap between all significant genes as well as all significant pathways in the biological condition comparisons.
Determination of protein levels by WesTM capillary electrophoresis
RAW264.7 cells were scraped in lysis buffer (20 mM Tris- HCl, pH 7.4, 5 mM EDTA, 0.15 M NaCl, 1% Triton X-100, 0.5% sodium deoxycholate) supplemented with protease inhibitor cocktail (Complete Mini; Roche, Boulogne-Billancourt, France) and phosphatase inhibitor cocktail (PhosSTOP, Sigma-Aldrich). Protein concentrations were determined using the BC Assay (Uptima/Interchim). WesTM analyses (capillary electrophoresis system; ProteinSimple, San Jose, CA) were performed according to the manufacturer’s recommendations, and adequate protein concentrations and antibody dilutions were determined in preliminary assays to allow optimal quantitative conditions. The microplates were loaded with 0.8 μg/μL protein, primary antibodies (as detailed below), and reagents provided by the manufacturer : anti-JAK1 (1:25 ; Biotechne MAB4260), anti-Phospho-JAK1 (1:100 ; Invitrogen 44422G), anti-JAK2 (1:13 ; Cell Signalling, 3230), anti-Phospho-JAK2 (1:13 ; Cell Signalling 3776), anti-STAT1 (1:50 ; Cell Signalling 9172), anti-Phospho-STAT1 (1:40 ; Biotechne AF2894), anti-Actin (1:1000 ; Millipore MAB1501R). Data were analysed using Compass for SW3.1 software (ProteinSimple). Protein levels were determined by chemiluminescence signal (AUC) and Phospsho-Protein levels were normalized to the total level of each protein of interest, after verification that actin levels do not differ between conditions.
Bitter Taste Receptors Screening
Bitter taste receptor cDNA were cloned into the pcDNA4 mammalian expression vector (Invitrogen) using full coding receptor sequences reported on UniProt database. The synthetic constructs were codon optimized (Genewiz) and combine the first 45 amino acids of rat somatostatin type 3 receptor at the amino terminus to improve plasma membrane targeting of the receptors in the heterologous system68. The FLAG epitope was added to the carboxy terminus without interfering with receptor functionality and can be used for immunocytochemistry. Calcium-mobilization assays were performed using human embryonic kidney cells (HEK293T) stably transfected with chimeric Gα16gust44 protein69. Cells were seeded in black, poly-D-lysine coated 96-well plates at a density of 35000 cells/100µL in high glucose DMEM supplemented with 10% dialysed fetal bovine serum and 1% penicillin/streptomycin. Twenty-four hours later, the cells were transiently co-transfected using Lipofectamine 2000 (Life Technologies) with one of the TAS2R synthetic optimized vectors or empty expression plasmid, as a negative control, and the pCMV-GCaMP5G construct (Addgene #31788) coding for a genetically encoded calcium indicator70,71. Twenty-four hours after transfection, cells were washed twice with C1 buffer (130 mM NaCl, 5 mM KCl, 10 mM HEPES, 2mM CaCl2, 5mM sodium pyruvate, pH7.4). 3-oxo-C12:2-HSL was solved in DMSO and further diluted in C1 buffer. Next, the cells were placed in a fluorometric imaging plate reader (Flexstation® 3, Molecular Devices) and stimulated with automatic injection of increasing concentrations of HSLs. Calcium responses leading to increase in fluorescence were monitored at 510 nm after excitation at 488 nm. Experiments were performed in duplicates and repeated at least four times. The recorded calcium levels of each wells receiving the same stimulus were averaged, response of mock-transfected cells were subtracted from receptor-transfected cells and net signals were normalized to background fluorescence (F/F0, F0 fluorescence light before stimulus application). The resulting dose-response curves of the averaged fluorescent signal amplitudes against the logarithm of the agonist concentration were fitted using Sigma Plot software. For data analysis, the four-parameter logistic equation [f(x)=min+(max-min)/(1+(x/EC50)nH)] was used to calculate the half-maximal effective concentrations (EC50 values).
RNA extraction and RT-qPCR
Total RNA was extracted from RAW264.7 cells using TRIzol (Invitrogen) according to the manufacturer's instructions. Reverse Transcription (RT) was performed with 1 μg RNA using LunaScript® RT SuperMix Kit (NewEngland Biolabs). Semi-quantitative real-time PCR was performed with the Mx3000P Stratagene system using SYBR Green (Applied Biosystems) according to the manufacturer's procedures. Cyclophilin was used as the reference gene. After amplification, Ct were determined. Sequences of the oligonucleotide primers used are reported in table 1.
Table 1
Sequence of the primers used in this study
Target gene (Protein)
|
Forward primer
|
Reverse primer
|
Tnf (TNFα)
|
CCAGACCCTCACACTGAGATC
|
CACTTGGTGGTTTGCTACGAC
|
Il1b (IL-1β)
|
AGTTGACGGACCCCAAAAG
|
AGCTGGATGCTCTCATCAGG
|
Il10 (IL-10)
|
CTGGACAACATACTGCTAACC
|
GGGCATCACTTCTACCAGGTA
|
Ppib (Cyclophilin B)
|
GCCTTAGCTACAGGAGAGAA
|
TTTCCTCCTGTGCCATCTC
|
Intracellular calcium assay
RAW264.7 cells were seeded in black, clear-bottom 96-well plates (Costar) at 20,000 cells per well. The next day, release of intracellular Ca2+ was measured using Fluo-4 (Fluo-4 Direct Calcium Assay; Life Technologies) according to the manufacturer’s instructions. Medium was discarded and 100 µL of 1 X Fluo-4 dye was incubated at 37 °C for 1h in 5 % CO2, protected from light. Then, basal fluorescence was measured using an fluorospectrometer (FLUOstar Omega; BMG Labtech), excitation at 485 nm and emission at 520 nm. Molecules of interest were then added with an electronic pipette; thapsigargin (10 µM, Sigma) as a positive control, 3-oxo-C12:2-HSL (1,000 µM) or DMSO 0.5 %; with 8 replicates per conditions for every experiment. The fluorescence signal was immediately measured every 80 seconds for 2 h. Results are expressed as a ratio of the fluorescence x times over the basal fluorescence (F/F0).
Quantification and statistical analysis
Data are expressed as means ± standard error of the mean (SEM) unless otherwise indicated. The number of independent experiments and replicates are indicated in the figure captions. Figures and statistical analyses were performed with Graphpad® Prism 8.0 (Ritme Informatique, Paris, France). Normal distribution was tested using Shapiro-Wilk test. When normal distribution was confirmed, statistical differences between the means were assessed by ANOVA or t-test otherwise by a non-parametric Kruskal-Wallis test. Post-test are indicated in the figure captions. For all results, p<0.05 was considered statistically significant. Values are represented as follows: * p≤0.05; ** p<0.01; *** p<0.001; p<0.0001.