In vitro cultures for peritoneal macrophages
Peritoneal macrophages were obtained from male Sprague–Dawley (SD) rats (10–12 weeks old; Daehan Bio Link, Chungju, Korea). Rats were housed in standard cages at a constantly controlled temperature (23–25°C) and humidity (45–50%) with a 12-h light/dark cycle. All animals had free access to food and water. Rats were injected intraperitoneally with 10 mL of 3% (w/v) thioglycollate (Becton Dickinson, Sunnyvale, CA, USA). Rats were euthanized from 4 days after injection, and their peritoneal cavity was opened. The peritoneal fluid was harvested from the peritoneal cavity by rinsing 40 mL of RPMI-1640 (Hyclone, South Logan, UT, USA), and then centrifuged at 4°C for 3 min at 1,500 rpm. The supernatant was discarded, and cell pellets were resuspended in 1 mL of red blood cell lysis buffer (Invitrogen, Carlsbad, CA, USA) at room temperature for 5 min and then washed in phosphate-buffered saline (PBS; Gibco, Grand Island, NY, USA). Macrophages were resuspended in RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco), and then seeded at 1 × 106 cells per well onto poly-d-lysine coated 12-mm glass coverslips (Paul Marienfeld GmbH and Co., Lauda-Königshofen, Germany) in 24-well plates for immunocytochemistry.
Iron(II) sulfate heptahydrate (FeSO4) and melittin treatment
Iron-mediated macrophage polarization was performed in an in vitro setting as described previously [20]. Briefly, primary macrophages were cultured in a poly-d-lysin coated plates for 24 h after cell seeding. For FeSO4 (Sigma-Aldrich, St. Louis, MO, USA) treatment after 24 h, an iron stock solution was prepared using 278 mg of FeSO4 dissolved in 10 mL PBS. After filtering using a 0.2-µm membrane, FeSO4 was added to the cell culture media at a final concentration of 50 µM for 30 min. After 30 min of incubation at 37°C in a CO2 incubator, melittin was added to the FeSO4-containing medium at a concentration of 200 or 500 ng/mL. The cells were further incubated in 5% CO2 at 37°C for 24 h, and samples were used for immunocytochemistry.
Immunocytochemistry
The macrophages were cultured in 200 or 500 ng/mL melittin, and the expression of macrophage M1 (CD86) and M2 (Arginase 1; Arg1) markers was detected by immunostaining after 24 h with five biological replicates per condition. Briefly, the samples were fixed with 4% paraformaldehyde (PFA; Biosesang, Seongnam, Korea) for 30 min and washed three times for 5 min each with PBS. The cells were permeabilized with 0.2% Triton X-100 in PBS for 5 min, washed two times and blocked with 2% normal goat serum (NGS) in PBS for 1 h. The following primary antibodies were used: Arg1 (1:200, Novus, Littleton, CO, USA), CD68 (1:500, Abcam, Cambridge, UK), and CD86 (1:100, BD PharMingen, San Diego, CA, USA). The primary antibodies were diluted in 2% NGS and incubated overnight at 4°C. After washing with PBS three times for 5 min each, the samples were then incubated for 2 h with fluorescein isothiocyanate (FITC) or rhodamine-conjugated secondary antibodies (goat anti-rabbit IgG or goat anti-mouse IgG; Jackson ImmunoResearch Laboratories, West Grove, PA, USA) diluted at 1:300 in 2% NGS. After 2 h of incubation at room temperature, the cells were washed three times for 5 min with PBS, mounted with fluorescence mounting medium (Dako Cytomation, Glostrup, Denmark), and images were acquired by confocal microscopy (Eclipse C2 Plus; Nikon, Tokyo, Japan). For quantification of macrophage polarization, five representative images were captured at 200× magnification with fixed acquisition parameters and analyzed using counting of ImageJ software. The numbers of CD86+ or Arg1+/ED1+ cell were counted, and the proportion of M1 or M2 double-positive cells was expressed as a percentage of cells that appear bright in response to CD86 or Arg1 by the number of ED1+ cells.
Rat LSS model and melittin administration
Male SD rats (7 weeks old, 230–250 g) were obtained from Daehan Bio Link (Chungju, Korea). Rats were housed as described above. Surgery was performed in accordance with previously published protocols [21]. After laminectomy at L5 level, a silicone block (80 kPa, 4 × 1 × 1 mm3) was inserted at the L4 level using no. 5 fine forceps. Sham-operated rats underwent laminectomy only at the L5 level without silicone insertion. The spinal cord was covered with Surgicel® absorbable hemostat (Johnson and Johnson, Arlington, TX, USA) to help achieve hemostasis in the spinal cord. All rats were injected intramuscularly with 40 mg/kg cefazolin sodium (Cefazolin®, Chong-Kun-Dang Pharm., Seoul, Korea) after suturing to prevent infection and administered an oral dose of 10 mg/kg Children’s Tylenol® (Janssen Korea, Inc., Seoul, Korea) after the anesthesia was resolved for pain management. Different concentrations of melittin (100 and 250 µg/kg) were administered once per day by subcutaneous injection. Injection was started at 30 min after LSS and continued for 1 or 3 weeks after LSS before sacrifice. The control group was administered the same volume (400 µL) of PBS.
Histology
Sham or LSS rats from each group were deeply anesthetized with 2–3% isoflurane gas and perfused via cardiovascular system with 0.9% normal saline (Sigma-Aldrich) and 4% PFA (Biosesang) for histological staining and immunohistochemistry. The spinal cord at the silicone implantation site was dissected, post-fixed overnight in 4% PFA at 4°C, and dehydrated with 30% sucrose in 0.1 M phosphate buffer for 3 days. The samples were cryo-sectioned at 20 µm in the sagittal plane. Hematoxylin and eosin (H&E) staining was performed at the L4 level to evaluate the degree of damage to the spinal cord caused by implantation of the silicone block at 3 weeks. Briefly, the sectioned tissue slides were dipped into hematoxylin for 2 min, washed in running tap water for 2 min, and then stained with eosin for 5 s. The stained sections were dehydrated through a graded series of ethanol, cleared with xylene, mounted with VectaMount® Permanent Mounting Medium (Vector Laboratories, Burlingame, CA, USA), and imaged under an inverted microscope (Nikon, Tokyo, Japan).
Immunohistochemistry
Immunohistochemistry was performed on spinal cord sections to analyze macrophage subset and pain- and iron-related markers. Primary antibodies against monocyte/macrophage rabbit anti-CD68 (1:500, Abcam), rabbit anti-TRPV1 (1:100, Alomone, Hadassah Ein Kerem, Israel), guinea pig anti-NeuN (1:500, Synaptic Systems, Göttingen, Germany), mouse anti-ferritin heavy chain (1:400, Santa Cruz Biotechnology, Dallas, TX, USA), CD86 (1:100, BD PharMingen), Arg1 (1:200, Novus), and mouse anti-NF200 (1:200, Millipore, Billerica, MA, USA) were incubated overnight at 4°C. The sections were then washed three times with PBS and secondary antibodies (FITC-coupled goat anti-mouse or anti-rabbit or rhodamine-conjugated goat anti-guinea pig, Jackson ImmunoResearch Laboratories) were treated at a 1:300 dilution in 2% NGS. Following incubation at room temperature for 2 h, the sections were washed three times with PBS and mounted with using Dako Mounting Medium (Dako Cytomation). The stained tissue sections were observed by confocal microscopy (Eclipse C2 Plus, Nikon). The fluorescence intensity was analyzed for confocal images captured by the same acquisition settings. Background was subtracted using the subtract background tool in ImageJ software (1.37 v, National Institutes of Health, Bethesda, MD, USA). CD68-positive macrophages were manually counted in the silicone implanted area using confocal microscopy images obtained at 100× magnification. The result was expressed as a percentage or ratio. NF200-labeled axons were quantified by using ImageJ. Briefly, NF200-labeled axons were captured at the implantation site under a 100× objective lens of a confocal microscope, and the number of pixels occupied by the NF200 fibers was counted in three images; NF200-positive pixels were divided by the number of pixels in a field.
RNA isolation and real-time polymerase chain reaction (qPCR)
Changes in the mRNA levels of genes related to inflammation (inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin (IL)-1beta (β), IL-6, IL-10, tumor necrosis factor-alpha (TNF-α), arginase 1 (Arg1)), iron metabolism (ferritin light polypeptide 1, ferritin heavy/light chain (FTH1/FTL), hepcidin antimicrobial peptide (HAMP), divalent metal transporter 1 (DMT1), transferrin receptor (TFRC), and ceruloplasmin (CP), and axon regeneration (neurofilament 200 (NF200), nuclear factor erythroid 2-related factor 2 (Nrf2), and Wingless-type family member 3, 5A (Wnt3, Wnt5a)) were analyzed by qPCR. Total RNA was extracted from the L4 spinal cord using a RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized using oligo dT primers and AccuPower RT PreMix (Bioneer, Daejeon, Korea). Primers were designed using the UCSC Genome Bioinformatics and NCBI databases and are listed in Table 1. Quantitative reverse-transcription PCR (qRT-PCR) was performed in triplicate using iQ SYBR Green Supermix with a CFX Connect Real-Time PCR Detection System (both from Bio-Rad, Hercules, CA, USA). Target gene expression was normalized to that of the β-actin gene and expressed as a fold-change relative to the control group.
Table 1
Primer sequences used for real-time PCR analysis.
Gene
|
5′-3′
|
Primer sequence
|
TFRC
|
Forward
|
GGCTATGAGGAACCAGACCGCTACA
|
|
Reverse
|
TGGACTTCGCAACACCAGGGC
|
DMT1
|
Forward
|
TGTCGCCTGTCCATTTGGCCG
|
|
Reverse
|
TGGCGTGGCGGGGTTGAAAT
|
FTH1
|
Forward
|
TTGCAACTTCGTCGCTCCGCC
|
|
Reverse
|
TGGCGCACTTGCGAGGGAGA
|
FTL1
|
Forward
|
GCAGCGCTTTGGAGATCCCG
|
|
Reverse
|
AGTCCCCGGGTCTGTTCCGT
|
CP
|
Forward
|
TGCAACAAGCCCTCACCGGA
|
|
Reverse
|
TGGTCTCCTCGGCAGCGATGTA
|
Hamp
|
Forward
|
TATCTCCGGCAACAGACGAG
|
|
Reverse
|
AGCGCACTGTCATCAGTCTT
|
iNOS
|
Forward
|
ATGGCTTGCCCCTGGAAGTT
|
|
Reverse
|
TGTTGGGCTGGGAATAGCAC
|
COX-2
|
Forward
|
CTCAGCCATGCAGCAAATCC
|
|
Reverse
|
GGGTGGGCTTCAGCAGTAAT
|
IL-1β
|
Forward
|
TTGCTTCCAAGCCCTTGACT
|
|
Reverse
|
GGTCGTCATCATCCCACGAG
|
IL-6
|
Forward
|
CCACCCACAACAGACCAGTA
|
|
Reverse
|
GGAACTCCAGAAGACCAGAGC
|
TNF-α
|
Forward
|
CCGACTACGTGCTCCTCACC
|
|
Reverse
|
CTCCAAAGTAGACCTGCCCG
|
Arg1
|
Forward
|
GTCTCCAGATGCCTTTGCTTC
|
|
Reverse
|
ATGAAATTCAGGGTGTGGGAAT
|
IL-10
|
Forward
|
TAACTGCACCCACTTCCCAG
|
|
Reverse
|
AGGCTTGGCAACCCAAGTAA
|
NF200
|
Forward
|
AACACCACTTAGATGGCGGG
|
|
Reverse
|
ACGTGGAGCGTTCAGCAATA
|
Nrf2
|
Forward
|
GATCTGTCAGCTACTCCCAG
|
|
Reverse
|
GCAAGCGACTCATGGTCATC
|
Wnt3
|
Forward
|
CCAATTTGGTGGTCCCTGGC
|
|
Reverse
|
TAATTGCGGCAGAAACGCAG
|
Wnt5a
|
Forward
|
GTTGAAGCCACAAGAGACAGC
|
|
Reverse
|
AGAGCATGAGCCTTTTCGGT
|
GAPDH
|
Forward
|
CCCCCAATGTATCCGTTGTG
|
|
Reverse
|
TAGCCCAGGATGCCCTTTAGT
|
Flow cytometry
Spinal cord tissues were isolated into single cells for FACS analysis. The tissue under silicone was dissociated using a Neural Tissue Dissociation kit (Miltenyi Biotec, Bergisch Gladbach, NRW, Germany) and gentleMACS Dissociator (Miltenyi Biotec). The dissociated cells were filtered in a 20-µm cell strainer (FALCON) and centrifuged at 2,000 rpm for 3 min. Flow cytometry was performed to assess cell death following LSS. Apoptotic cell death was detected using a FITC Annexin V Apoptosis Detection Kit I (BD Bioscience, Franklin Lakes, N, USA). Briefly, the cells were collected and stained with 1 µL of Annexin V-phycoerythrin and 1 µL of propidium iodide in 200 µL of 1× binding buffer and directly analyzed by fluorescence-activated cell sorting (Accuri C6 Plus Flow Cytometer, BD Biosciences). In addition, ferroportin expression was evaluated by ferroportin/SLC40A1 antibody (Novus) after fixation with fixation buffer (BD Bioscience). The mean positive cell values, as determined via flow cytometry, were expressed as a percentage relative to the control group.
Enzyme-linked immunosorbent assay
The expression levels of the pro- and anti-inflammatory markers IL-6 and IL-10 in a separated spinal cord, including at the implantation site, were evaluated by enzyme-linked immunosorbent assay (ELISA). The spinal cord tissues were homogenized in radioimmunoprecipitation assay buffer (GenDEPOT, Barker, TX, USA) containing a proteinase inhibitor (Millipore) using a Taco™ Prep Bead Beater (GeneReach, Taichung, Taiwan) and centrifuged at 1,000 rpm at 4°C for 3 min. Protein concentration was quantified using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA). The supernatants were examined using ELISA kits (BD Biosciences) according to the manufacturer’s instructions. The final concentrations of cytokines were calculated with respect to the amount of each protein.
Functional assessments
Locomotor function was assessed for 3 weeks using three tests after LSS. The Von Frey test was used to measure the foot response to pain. The rats were placed in acrylic cages for 15 min and then stimulated at the test area on the plantar surface. We measured the latency of paw withdrawal in response to mechanical stimulation using a Von Frey filament (Ugo Basile, Varese, Italy). Each value was automatically recorded from three or more measurements and then averaged. The BBB scale was assessed in an open field for 4 min by two independent observers, and the BBB score was calculated from the average of hindlimb movements. The ladder walking test was also performed to confirm the balance and forelimb-hindlimb coordination. All rats walked the runway (2.5-cm interval) from left to right three times, and their movements were recorded using a digital camera and calculated as follows: ladder score (%) = erroneous steps of hind limb/total steps of hind limb × 100.
Statistical analyses
All numeric data are expressed as the mean ± standard error of the mean. Comparisons among each group were analyzed using one-way analysis of variance (ANOVA) with Tukey’s post-hoc analysis (Graph-Pad Prism 8, Inc., La Jolla, CA, USA). Differences were considered as statistically significant if the p value was #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001 vs. the blank or sham group and *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001 vs. the FeSO4 or control group.