Plant materials
The leaves, stems, roots, flowers, fruits and seeds of T. kirilowii were collected from the medicinal botanical garden of Huazhong Agricultural University and immediately frozen in liquid nitrogen and stored at -80 oC for RNA extraction.
RNA isolation and cloning of TkAAI
Total RNA was isolated via the total RNA Kit (Promega). The extracted RNA was quantified using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, San Jose, California, USA) and the integrity was further analyzed by 1% agarose gel electrophoresis. Prior to cDNA synthesis, total RNA was treated with a DNase to remove DNA contamination from the samples. The first cDNA fragment was synthesized by reverse transcription using the Oligo(dT) primer, AA7-F(5’-CCTACCGCACCACTATCACCA-3’), and 2 mg total RNA as the template according to the instructions of the PrimeScript@1stStrand cDNA Synthesis Kit (TaKaRa, Japan). In order to isolate the TkAAI specific fragments from T. kirilowii, a 326 bp fragment was amplified from cDNA prepared from seeds. Two Primers AA7-F (5’-CCTACCGCACCACTATCACCA-3’) and AA7-R (5’- GAGACCATTTAGAAGTCGCATCG -3’) which contained a conserved sequence were designed based on the homology of the TkAAI from M. charantia (gi|21327880|), Cucurbita cv. (gi|459404|). The degenerate PCR reaction was conducted in a total volume of 20 µL mixture containing 12.7 µL of ddH2O, 2.0 µL of 2.5 mM dNTP mixture, 2.5 µL of Ex Taq buffer (Takara), 0.3 U Ex Taq (Takara), 0.5 mM of each primer, and 1.0 µL of cDNA (50 ng/µL). PCR was performed using the thermal cycle profile of 94 oC 3 min, 35 cycles of 94 oC 30 s, 55 oC 30 s and 72 oC 1 min, and a final extension of 10 min at 72 oC. One amplified product was recovered using the DNA rapid purification kit (Axygen). The purified PCR products were ligated into pMD-18T vector (Takara) and then transformed to competent E. coli DH 5α cells for sequencing. RACE-PCR was processed to obtain the 3’end and 5’end of the cDNA sequence of TkAAI via Terminal deoxynucleotidyltransferase as previously described [17, 18]. 3’ RACE: The cDNA first strand was synthesized by reverse transcription using QT (5’- CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT- 3’), GSP-5F (5’- AAGAAGGCGGGTCCTTTGAT- 3’) and QO (5’- CCAGTGAGCAGAGTGACG-3’) were designed to amplify 3’ RACE products. 5’ RACE: The cDNA first strand was synthesized by reverse transcription using AA7-R (5’- GAGACCATTTAGAAGTCGCATCG -3’), add poly A to the purified cDNA using TdT and dATP, QT(5’-CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT-3’), QO (5’- CCAGTGAGCAGAGTGACG- 3’) and GSP-3R (5’- ATCAAAGGACCCGCCTTCTT-3’) were designed to amplify 5’ RACE product. The RACE-PCR products were analyzed on 1.2% (w/v) agarose gels, purified, and cloned into the pMD-18T vector (Takara), and sequenced (Sangon, Shanghai). After the complete sequences of the 5’-end and the 3’-end were obtained, the full cDNA length of TkAAI was established by assembling analysis.
Characterization
The physical and chemical properties of the deduced TkAAI protein were determined using the Expasy ProtParam Tool (https://web.expasy.org/protparam/). The subcellular localization was predicted through TargetP-2.0 (http://www.cbs.dtu.dk/services/TargetP/). The sequence analysis was performed via the InterProScan online website(http://www.ebi.ac.uk/interpro/). The predicted TkAAI protein sequences were aligned with their orthologs and other members of TkAAI super family using the BLASTX program, from the database of NCBI (https://www.ncbi.nlm.nih.gov/). Multiple sequence alignments were viewed and edited using the ClustalW (https://www.genome.jp/tools-bin/clustalw) and ESPript (https://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). For the phylogenetic analysis, TkAAI amino acids sequences were aligned with their orthologs in other seed plant species using ClustalW and MAFFT software [19]. The evolutionary history was inferred by using MEGA7 with the Neighbor-Joining analysis method (https://robetta.bakerlab.org/)[20]. Phylogenetic tree was constructed online by itol (https://itol.embl.de/). TkAAI protein tertiary structure via SWISS-MODLE (https://swissmodel.expasy.org/interactive) and Robetta (https://robetta.bakerlab.org/). The accuracy of the tertiary structure models is determined by Savesv6.0 (https://saves.mbi.ucla.edu/).
Gene expression pattern analysis of TkAAI in various organs
Real-time PCR amplification and analysis was performed on CFX96™ Real-Time PCR System (Bio-Rad, California, USA) via SYBR® Premix Ex Taq™ (Tli RnaseH Plus) (TaKaRa, Japan). Primers (GSP-F 5’- AAGAAGGCGGGTCCTTTGAT -3’, GSP-R 5’- TCTGCTCCTCCCTAGCAATCT -3’) used for real-time PCR were designed to amplify 100-120 bp fragments from full-length cDNA of TkAAI. A constitutively expressed housekeeping gene, GAPDH (GAPDH-F 5’- TGCACTACCAACTGCCTAGC -3’, GAPDH-R 5’- CCTTCACCAAGTCATCCCCC- 3’) from cucumber, was used for normalization in the quantification of the gene expression in different tissues. qPCR was performed at a final volume of 20 µl containing 1 µL cDNA, 0.5 µL of each primer diluted to 10 mM, 10 µL SYBR® Premix Ex Taq™, and 7 µL ddH2O. The thermal cycle condition used in real-time PCR was: 94 oC for 1 min, followed by 40 cycles of 94 oC for 10 s, and 56 oC for 20 s. Following the real-time PCR cycles, the specificity of the SYBR green PCR signal was confirmed by melting curve analysis. Data analysis was performed according to the instructions of the manufacturer of the quantitative real-time PCR instrument CFX96™ management software. The expression level for each sample was calculated as 2−ΔΔC(t) where Ct represents the cycle number when the fluorescence signal in each reaction reaches the threshold. All samples were repeated three times.
Protein expression and purification
Firstly, amplify the TkAAI coding sequence and reporter gene eGFP fragments. Prokaryotic expression plasmid pET28a was linearized by PCR. Primers for TkAAI, (TkAAI-F 5’- CTTTAAGAAGGAGATAT-ACCATGGCAAGACTCACAGGTATCATTG- 3’, TkAAI-R 5’- TCCTCGCCCTTGCTCACCATTGCT-GCTGCTGCTGCTGCGAAGGCGCATCGGTCT -3’) eGFP (eGFP-F 5’- GCCCAGACCGATGCG-CCTTCGCAGCAGCAGCAGCAGCAATGGTGAGCAAGGGCGAGGAGCTG -3’, eGFP-R 5’- CTTC-CTTTCGGGCTTTGTTAGTGGTGGTGGTGGTGGTGCTTGTACAGCTCGTCCATGCCGAG -3’) and pET28a (Vector-R 5’- GCATGGACGAGCTGTACAAGCACCACCA-CCACCACCACTAACAAAGCCC-GAAAGGAAGCTGAGT-3’, Vector-F 5’-ATACCTGTGAGTCTTGCCATGGTATATCTCCTTCTTAA-AGTTAAACAAAATTATTTCTAGAG-3’) were used to amplified these three sequences, purified the PCR products using QIAquick PCR Purification Kit (Cwbio, China), three purified TkAAI and eGFP fragments were assembled into linearized pET28a to generate TkAAI-eGFP-pET28a plasmid. The recombinant vector was transformed into E. Coli BL21(DE3) strain for expression of TkAAI-eGFP fusion protein. Then E. coli BL21(DE3) cells harbouring the expression vector TkAAI-eGFP-pET28a were cultured in LB broth containing 50 µg/ml kanamycin overnight, the cells were cultured for 12 h with 0.2 mM isopropyl-b-D-thiogalacto-pyranoside (IPTG) in 16 oC for induction, harvested and then disrupted by sonication on ice. After centrifugation (12,000 g, 10 min at 4 oC), the resulting supernatant was purified by Ni–NTA affinity column chromatography (TransGen, China) and His-tagged recombinant protein was eluted with a linear gradient of 100-300 mM imidazole in 50 mM 2-Amino-2-(hydroxymethyl)-1,3-propanediol (Tris-HCL) buffer (pH 7.9).
Western blotting analysis
Purified protein was analysis by 10% SDS–PAGE (80 V, 2.5 h) and transferred to the polyvinylidene difluoride (PVDF) membrane (100 V, 1.5 h). Then immersed the PVDF membrane into 1×TBST (3% (w/v) skim milk) for 2 hours at room temperature. Washed the membrane by 1×TBST for three times, incubated the membrane with primary antibody diluted in 1×TBST (3% (w/v) skim milk, 1:5,000) and shaken for 2 hours, washed the membrane as mentioned before. Incubated the membrane with anti-eGFP secondary antibody diluted in 1×TBST (3% (w/v) skim milk, 1:10,000) and shaken for 1 hour, washed the membrane as mentioned before. Specific binding was detected with omnipotent imaging system (Bio-Rad).
Alpha-amylase inhibitory activity assays
The purified protein was concentrated to 0.2 mg/mL by molecular weight cutoff (MWCO) with 10kDa ultrafiltration tube (Merk). 20 µL (4 µg) of TkAAI-eGFP solution and 20 µL of porcine pancreatic amylase (PPA) solution (1 units/ml) were incubated at 37 °oC for 10 minutes, then reaction was started by the adding 50 µL 1% (w/v) soluble starch solution to 20 mM phosphate buffer (pH 6.9, containing 6.7 mM sodium chloride), and accurately incubated for 8 min at 37 °oC. The reaction was immediately stopped by adding 50 µL NaOH (1 M) solution, filled in 50 µL DNS color reagent solution (Solarbio, Beijing) and heated up to 100 °oC for color reaction for 10 min. After the reaction, cooled the mixture to room temperature and added 100 µL distilled water. The 200 µL samples were taken to measure the absorbance at 540 nm. The formula for calculating the inhibition activity of alpha-amylase inhibition was shown as:
$$Inhibition\left(\%\right)=1-\left(\frac{{A}_{s}-{A}_{b}}{{A}_{t}-{A}_{c}}\right)\times 100\%$$
As is the absorbance of the mixture of TkAAI-eGFP, starch solution, alpha-amylase solution and DNS color reagent solution. Ab is the absorbance of the mixture of TkAAI-eGFP, starch solution, phosphate buffer (replace alpha-amylase solution) and DNS color reagent solution. At is the absorbance of the mixture of phosphate buffer (replace TkAAI-eGFP), starch solution, alpha-amylase solution and DNS color reagent solution. Ac is the absorbance of the mixture of phosphate buffer (replace TkAAI-eGFP and alpha-amylase solution), starch solution, and DNS color reagent solution.