Strain isolation and observation
M. acerina strains were collected from six major P. notoginseng production regions, including Honghe, Wenshan, Qujing, Kunming, Lijiang, and Puer in Yunnan Province (Table 1). The geographical distribution of the samples shown in Figure 8. M. acerina were obtained using tissue isolation [57]. The junction between healthy and diseased tissue was washed using sterilized water and then immersed in alcohol (75%) for 2–3 min and washed again using sterilized water and dried on sterilized filter paper. Afterward, the samples were transferred into PDA medium and cultivated at 20°C for 4d. Then, we verified the isolates based on Koch postulates and pured by hyphal-tipped. M. acerina was identified based morphological characteristic and ITS sequence.
DNA extraction and polymerase chain reaction amplification of internal transcribed spacer (ITS1/4) regions
Genomic DNA was extracted from 0.2 g of mycelium using the Omega Fungi DNA Kit (Kunming Shuoqing Biological Engineering Technology Co. Ltd., Kunming, China) according to the manufacturer’s instructions. Amplification reactions were performed in a 20 μL volume containing 1 μL template DNA, 10 μL mix (DNA polymerase, Buffer, dNTP), 1 μL primer ITS1 (TCCGTAGGTGACCTGCGG), 1 μL primer ITS4 (TCCTCCGCTTATTGATATGC), and 7 μL ddH2O. Polymerase chain reaction (PCR) was performed using a T1 thermocycler (Biometra, Germany), with initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 45 sec, 60°C for 45 sec, and 72°C for 90 sec, and a final extension at 72°C for 10 min. Amplification products were separated by electrophoresis on 1% agarose gels in a 0.5× TAE buffer, using a 2000-bp DNA ladder as a DNA molecular weight marker. The PCR products were sequenced at Kunming Shuoqing Biological Engineering Technology Co. Ltd. Molecular Evolutionary Genetics Analysis (MEGA 5.1) was used to construct a phylogenetic tree based on the neighbor-joining method. Bootstrap values were evaluated using 1,000 replications [58].
Simple sequence repeat screening
SSRs were screened using MISA (http://pgrc.ipk-gatersleben.de/misa/) based on the whole genome data of M. acerina [59, 60]. MISA is a script written in Perl language, which can identify SSRs from genome FASTA files [61], MISA is simple to run without networking, and does not require high hardware. It has become the tool of choice for most SSR researchers. In the SSR parameter settings, we defined that six, five, four, three, two, and one base were repeated five, five, five, five, six, and ten times.
The genome (Accession: PRJNA809504) used in this study was sequenced using Hiseq 2500 from Illumina. After sequencing, two sets of 101bp long and short paired-end short sequence data were generated. M.acerina produced a total of 20.502 Gb original sequence, after filtering quality control, remove the linker sequence, low-quality base sequence and low sequence complexity sequence. The K-mer parameter is 75, and the final assembly result is obtained after automatic assembly and gap filling using SOAP denovo software (BGI, Shenzhen, China). The assembled size of M. acerina is 39Mb in total. The N50 index is an evaluation index for the continuity of genome assembly, this value is calculated by sorting the contig sequence length from largest to smallest. The larger the N50 value, the better the continuity of the contig generated by the assembly. In this study, M. acerina genome assembly contig N50 is 151kb, scaffold N50 is 567kb, the assembly quality is credible.
Primer design
SSR primers for the whole genome of M. acerina were designed in the PRIMER 3.0 (http://Frodo.wi.mit.edu/primer3) website [62] based on the screened SSR results. The primers were synthesized by Shuoqing Biological Engineering Technology Co. Ltd.
For the initial screening, 24 isolates from different sources, 118 SSR primers were designed and amplified with 20-μL PCR mixtures. All the amplification products were separated on 2.5% agarose gels in 0.5× TAE buffer, using a 100-bp DNA ladder as a DNA molecular marker (Raju, Sheshumadhav and Murthy, 2008). The primers with clear, specific, and target bands (100~500 bp) could be tested by automatic electrophoresis apparatus (Qsep100TM). Finally, the polymorphism of primers was assessed using CERVUS 3.0 [63], and the primers in which PIC exceeded 0.5 were retained for use genetic diversity analyses [64].
SSR analysis of Mycocentrospora acerina genome
Based on the initial results, 14 primer pairs with high polymorphism in M. acerina populations were selected (MP30, MP36, MP47, MP50, MP51, MP56, MP61, MP62, MP63, MP68, MP84, MP92, MP113, and MP114) for use in amplification reactions. Stable and clear fragments ranging in size between 100 bp and 800 bp were transformed into a binary character matrix (1 = presence, 0 = absence) [65, 66].
Statistical analysis
Genetic diversity parameters of each geographic population, including observed number of alleles, effective number of alleles, Nei’s diversity index, Shannon’s information index, total gene diversity, intrapopulation gene diversity, the coefficient of gene differentiation, and gene flow [67], were calculated using POPGENE 32 (version 1.32) [68]. NTSYS-pc (version 2.0) was used to calculate genetic similarity coefficient [69]. The phylogenetic tree was analyzed using unweighted pair-group algorithm with arithmetic averages clustering analysis [70].