Mice corneal infection
8-week-old C57BL/6 female mice were provided by Jinan Pengyue corporation (Jinan, China). After anesthetization, the 2 mm-diameter central corneal epithelium of mice left eyes was scraped. 108 colony forming units (CFU) /mL A. fumigatus (5 μL) was added on the surface of mouse corneas and then covered with a contact lens. All animal experiments abided by the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
Treatment of mice with flavopiridol
The left eyes of mice (n = 5/group) were treated with 5 μL of flavopiridol (5 μM; MCE, New Jersey, America) by subconjunctival injection at 1 day post infection (p.i.). Then, the left eyes were treated topically with 3 μL of flavopiridol (5 μM; MCE) twice a day from 2 day p.i. In control group, the left eyes of mice were treated with equivalent DMSO (Thermo Fisher Scientific, Waltham, MA, USA).
Cell culture and fungal stimulation
The culture conditions for RAW 264.7 cells have been elaborated previously (Li et al. 2015). When the confluence of cells reached 80%, cells were transferred into serum-free DMEM and stimulated with A. fumigatus (5×106 CFU mL-1).
Treatment of RAW 264.7 cells
Before fungal stimulation, RAW 264.7 cells were incubated with flavopiridol (200 nM; MCE) or DMSO for 2 hours. In 3-methyladenine (3-MA) group, RAW 264.7 cells were pre-treated with the inhibitor of autophagy, 3-MA (50 μM; MCE), for 1 hour before flavopiridol treatment. The mRNA levels of cytokines including IL-1β, IL-6, TNF-a and IL-10 were measured at 8 hours p.i. The protein levels of IL-6, TNF-a and IL-10 were measured at 24 hours p.i.
Cell Counting Kit-8 assay
RAW 264.7 cells were incubated with flavopiridol (50, 100, 150 and 200 nM) or DMSO for 24 or 48 hours. Cell Counting Kit-8 assay (MCE) was used to detect the cell viability after incubation with flavopiridol.
RT-PCR
Total RNA was extracted from mouse corneas and RAW 264.7 cells. The PCR method was described previously [25]. The primers used are exhibited in Table 1.
Table 1
Gene
|
GenBank No.
|
Primer sequence (5’-3’)
|
Mouse β-actin
|
NM_007393.5
|
F: GATTACTGCTCTGGCTCCTAGC
R: GACTCATCGTACTCCTGCTTGC
|
Mouse IL-1β
|
NM_008361.4
|
F: CGCAGCAGCACATCAACAAGAGC
R: TGTCCTCATCCTGGAAGGTCCACG
|
Mouse IL-6
|
NM_001314054.1
|
F: TGATGGATGCTACCAAACTGGA
R: TGTGACTCCAGCTTATCTCTTGG
|
Mouse TNF-a
|
NM_001278601.1
|
F: TTCTGTCTACTGAACTTCGGGGTGATCGGTCC
R: GTATGAGATAGCAAATCGGCTGACGGTGTGGG
|
Mouse IL-10
|
NM_010548.2
|
F: TGCTAACCGACTCCTTAATGCA
R: TTCTCACCCAGGGAATTCAAA
|
ELISA
Normal corneas and infected corneas were homogenized in PBST with the protease inhibitor (MCE) and then centrifuged. RAW 264.7 cells supernatants were collected and centrifuged. Each sample was diluted to the appropriate concentration. The protein expressions of IL-1β, IL-6, TNF-a and IL-10 were detected by ELISA kits (BioLegend, CA, USA).
Transmission electron microscopy
RAW 264.7 cells were treated with DMSO or flavopiridol for 2 hours, and then stimulated by fungi for 8 hours. Then cells were scraped off and placed in a microcentrifuge tube. After centrifuged at the speed of 3000 rpm for 10 minutes, cell precipitate was obtained and fixed in 2.5% glutaraldehyde. Mouse corneas were removed and fixed in 2.5% glutaraldehyde. The preparation steps of samples before transmission electron microscopy (TEM) observation were described in the previous study (Liu et al. 2019).
Immunofluorescence staining
RAW 264.7 cells were pretreated with 200 nM flavopiridol or DMSO for 2 hours, and then incubated with A. fumigatus for 8 hours. Cells were fixed on the poly-L-lysine-coated slips by 4% paraformaldehyde for 15 minutes. The immunofluorescence protocol was elaborated previously (Zhou et al. 2012). The anti-LC3B antibody (1:1000; Abcam, Cambridge, UK), anti-Beclin-1 antibody (1:200; Abcam) and anti-Atg-7 antibody (1:300; Abcam) were used as primary antibodies. The FITC-conjugated goat anti-rabbit antibody was used as the secondary antibody (1:200; Abcam).
Western blot
Proteins were extracted from mouse corneas and cells by using RIPA lysis and extraction buffer (Thermo Fisher Scientific), 1 mmol/L phenylmethanesulfonyl fluoride (Solarbio, Beijing, China) and 1 mmol/L phosphatase inhibitor (MCE). The concentration of extracted protein was measured by the BCA protein quantification kit (Solarbio). After protein denaturation, electrophoresis and electrophoretic transfer, proteins were moved onto PVDF membranes (Jiang et al. 2020). The membranes were blocked by blocking agent (Thermo Fisher Scientific), and then incubated with primary antibodies and secondary antibodies. The primary antibodies used include β-actin antibody (1:1000; CST, USA), β-tubulin antibody (1:1000, CST), LC3B antibody (1:2000; Abcam), Beclin-1 antibody (1:2000; Abcam) and Atg-7 antibody (1:10000; Abcam).
Phagocytosis
RAW 264.7 cells (100 μL, 1 × 106 cells/mL) were incubated with 200 nM flavopiridol or DMSO for 2 hours. Cells were centrifuged and then resuspended in 100 μL DMEM. Next, cells were treated with equivalent numbers of conidia at 37 °C. At 0 min and 120 min, 50 μL of the suspension described above was added to 150 μL of HBSS solution. After centrifugation (110g/min, 4 min), 100 μL supernatant was tiled on Sabouraud medium plate and the number of fungal colonies was counted. Phagocytosis was measured by calculating the reduction of ectocytic conidia left in the supernatant. The formula is as follows: phagocytic index P (120min) = (1-N120/N0) × 100%. N0 and N120 represented the number of ectocytic conidia at 0 min and 120 min respectively (Perkhofer et al. 2007, Novakowski et al. 2017).
A. fumigatus growth analysis
A. fumigatus strain 3.0772 was provided by The China General Microbiological Culture Collection Center (China). A. fumigatus was incubated with DMSO and flavopiridol (200, 400 and 800 nM; MCE) in 96-well plate for 1, 2, 3 ,4 and 5 days. The absorbance of fungi was measured at 540 nm. Fungi was also stained with Calcofluor white (Sigma, Santa Clara, CA, USA) for 10 minutes. The images of stained-hyphae were captured and the fluorescence intensity was measured.
Fungal biofilm formation assay
The preparation of fungal biofilm formation has been described in previous publications (Wiederhold et al. 2018). The fungal biofilms were incubated with DMSO and flavopiridol (200, 400 and 800 nM) for 48 hours. Biofilms were fixed with methanol and stained by 0.1% crystal violet. After washed for three times, ethanol was used to release crystal violet bounded to biofilms. The absorbance was detected at 570 nm three times.
Fungal adherence assay
HCECs (2×104/mL) were treated with the mixture of conidia suspension (at an MOI of 10) and 200 nM flavopiridol or DMSO, and plated on chambered slides (Cameron et al. 1988). After incubation for 3 hours at 37°C, hematoxylin and eosin (HE) were used to stain the conidia and cells. The images of adherent conidia to HCECs were captured by microscopy (Thermo Fisher Scientific, 600×).
Statistical analysis
Student’s t-test was used to analyze differences between two groups. One-way ANOVA was used to evaluate differences among three or more groups. Differences were considered significant at P ≤ 0.05. All data are shown as the mean ± SEM.