Animals and Diets. Male senescence-accelerated mouse prone (SAMP) and senescence-accelerated mouse resistant (SAMR) were purchased from Japan SLC, Inc. (Shizuoka, Japan) and maintained at the Gifu University Animal Facility under controlled conditions of humidity (50±10%), light (12/12 h light/dark cycle), and temperature (23±2°C) according to the institutional animal care guidelines. All mice were housed in plastic cages with free access to drinking water (tap water) and maintained with a choline-deficient, L-amino acid-defined, high-fat diet (CDAHFD, #A06071302, Research Diets, Inc., New Brunswick, NJ, USA) or a control diet (#A06071314, Research Diets, Inc.). CDAHFD has been reported to be an NASH-inducing diet in a previous paper 9. All methods are reported in accordance with ARRIVE guidelines (https://arriveguidelines.org) and were carried out in accordance with relevant guidelines and regulations.
Experimental Procedure. Fifteen SAMR and 15 SAMP were quarantined for the first seven days, following which they were separated into several groups. Six SAMRs in Group 1 and six SAMPs in Group 2 were fed the control diet. Nine SAMRs and nine SAMPs were in Groups 3 and 4, respectively, and they were all given CDAHFD. All mice at 20 weeks of age were euthanised after 12 h of fasting. Blood samples were collected from the inferior vena cava for clinical chemistry, and organs and tissues, including the liver, tibialis anterior, and gastrocnemius muscles, were removed for histopathological and biological examinations. The experimental protocol was approved by the Committee of Institutional Animal Experiments of Gifu University (authorization code 2020‑267).
Blood Biochemistry. The whole blood was centrifuged, and serum was obtained and used for chemical analyses. Serum alanine aminotransferase (ALT) levels were determined at a commercial laboratory (SRL, Inc., Tokyo, Japan). As a marker for oxidative stress in the liver, the levels of 8‑hydroxy‑2’‑deoxyguanosine (8-OHdG) were determined using an ELISA kit (NIKKEN SEIL Co. Ltd., Shizuoka, Japan). Serum IGF-1 and TNF-α levels were measured using the IGF-1 Mouse ELISA Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) and Mouse TNF-alpha Quantikine ELISA Kit MTA00B (R&D Systems, Inc., Minneapolis, MN, USA), respectively, in accordance with the manufacturer’s protocols.
Histological Analysis and Immunohistochemistry. For histological evaluation, the liver and muscle tissues were fixed in 10% buffered formalin, embedded in paraffin, and stained with haematoxylin and eosin. Sirius red staining was performed to determine the presence of fibrosis in the liver. Histological features of the liver were evaluated using the non-alcoholic fatty liver disease (NAFLD) activity score (NAS) system 1011.
RNA extraction and quantitative real-time reverse transcription-PCR analysis. Total RNA was isolated from the liver and skeletal muscle of the experimental mice using the Rneasy Mini Kit (QIAGEN, Venlo, Netherlands). cDNA was synthesised from total RNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Quantitative real-time reverse transcription-PCR (RT-PCR) analysis was performed using the LightCycler 96 System (Roche Diagnostics, Indianapolis, IN, USA) with LightCycler 480 SYBR Green I Master Mix (Roche Diagnostics). The specific primers used for amplifying Asma, Atrogin1, Col1a1, F4/80, Igf1, Inos, Murf1, Tgfb1, Tnfa, and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) genes were obtained from previous reports 12131415 designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The sequences of the primers are listed in Table 1. The expression levels of these genes were normalised to the level of Gapdh.
Table 1
Target gene | Forward | Reverse |
Asma | ctctcttccagccatctttcat | tataggtggtttcgtggatgc |
Atrogin1 | GCAAACACTGCCACATTCTCTC | CTTGAGGGGAAAGTGAGACG |
Col1a1 | catgttcagctttgtggacct | gcagctgacttcagggatgt |
F4/80 | ACAAGACTGACAACCAGACGG | TAGCATCCAGAAGAAGCAGGCGA |
Gapdh | GACATCAAGAAGGTGGTGAAGCAG | ATACCAGGAAATGAGCTTGACAAA |
Igf1 | tcggcctcatagtacccact | acgacatgatgtgtatctttattgc |
Inos | CGAAACGCTTCACTTCCAA | TGAGCCTATATTGCTGTGGCT |
Murf1 | ACCTGCTGGTGGAAAACATC | CTTCGTGTTCCTTGCACATC |
Tgfb1 | ACCGGAGAGCCCTGGATACCA | TATAGGGGCAGGGTCCCAGACA |
Tnfa | TGGCCCAGACCCTCACACTCAG | ACCCATCGGCTGGCACCACT |
Metabolome Analysis. The metabolome measurements were carried out at Human Metabolome Technologies, Inc. (Tsuruoka, Japan), and the concentrations of the targeted metabolites were measured and analysed as previously described 16. Briefly, approximately 50 mg of frozen skeletal muscle was cast into 50% (v/v) acetonitrile in Milli-Q water with 20 µM internal standards. The tissue was homogenised and the homogenate was centrifuged. Subsequently, the upper aqueous layer was filtered by centrifugation to remove the proteins. The filtrate was concentrated and resuspended in Milli-Q water for capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS) and capillary electrophoresis–triple quadrupole mass spectrometry (CE-QqQMS) analysis using an Agilent system (Agilent Technologies, Santa Clara, CA, USA). Peaks identified in CE-TOF/MS and CE-QqQMS analyses were extracted using automatic integration software (MasterHands version 2.17.1.11, Keio University) 17 and MassHunter Quantitative Analysis B.06.00 service pack (Agilent Technologies), respectively.
Statistical Analyses. Hierarchical cluster analysis (HCA) and principal component analysis (PCA) were performed using the statistical software developed by Human Metabolome Technologies Inc. To compare specific groups, one-way analysis of variance (ANOVA) was used following Shapiro-Wilk normality test. If the ANOVA exhibited significant differences, the Tukey-Kramer multiple comparison test was performed on items to confirm statistical significance. Kruskal-Wallis test and following Steel-Dwass test were performed for non-parametric statistical analysis. Data were presented as mean ± standard deviations and statistical significance was set at P < 0.05.