Transcriptome Analysis, CmMYB1&nbsp;Gene Clone From Cucumis Melo L. And Its Functional Roles Under Salt Stress&nbsp;&nbsp;

doi:10.21203/rs.3.rs-121474/v1

Download PDF

Research Article

Transcriptome Analysis, CmMYB1 Gene Clone From Cucumis Melo L. And Its Functional Roles Under Salt Stress

https://doi.org/10.21203/rs.3.rs-121474/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

MYB TFs plays an important role in plant adaptation to abiotic stress, especially in response to salt stress. Preliminary research found that the stress resistance of the two melon varieties ‘M15’ and ‘baogua’ are quite different. To this end, we compared the transcriptomes of ‘M15’ and ‘baogua’. Transcriptome analysis found that the expression levels of 12 MYB transcription factors were significantly different between the two varieties.CmMYB1 gene was cloned from muskmelon (Cucumis melo L.), and the subcellular localization results showed that CmMYB1 was expressed in the cytoplasm and nucleus. Transform CmMYB1 gene into Arabidopsis thaliana, observe T3 phenotypes during the vegetative and reproductive growth periods.The results showed that the transgenic A. thaliana phenotype did not change significantly compared with the wild type . After treatment with 200 mM sodium chloride solution for 1 h and 3 h, the CmMYB1 expression increased significantly and began to decline after 6 h of salt stress, indicating that it functions in the early response to salt stress. These results provide a theoretical basis for the further study of the biological function of CmMYB1.

Molecular Genetics

Transcriptome

melon

CmMYB1

salt stress

MYB transcription factors (MYB TFs) are a large and diverse family, expressed in all eukaryotes[1].The N-terminal amino acid residue has a conserved DNA binding domain, which binds to the promoter region of genes and regulates gene expression.According to the repeats number of the conserved DNA binding domain at the N-terminus of the MYB transcription factor, it is divided into 4 categories: 1R-MYB (including MYB-related), R2R3-MYB, 3R-MYB and 4R-MYB[2]. Currently, dicotyledonous plants such as Arabidopsis[2], Populus trichocarpa[3], grapes[4] and monocotyledonous plants such as corn[5]and rice [6], we have a more comprehensive understanding of the classification and function of MYB TFs.

Among the 4 types of MYB TFs, R2R3-MYB has the largest number and is mainly involved in regulating plant-specific growth and metabolic pathways.R2R3-MYB can regulate the life cycle of cells; regulate plant growth and development; regulate primary and secondary metabolites, such as flavonoids[7] and flavonols [8,9], anthocyanins and procyanidins[10,11], theanine[12]; participate in the regulation of secondary cell wall synthesis[13,14]; regulation of hormone signaling[15–17]; resistant biological and abiotic stresses[18–21].

In recent years, the planted melon cultivation area in my country has expanded rapidly, but soil salinization will harm its growth and development, and reduce the yield and quality of melon.At present, the research on genes related to salt stress in melon is mainly focused on vacuolar membrane Na+/H + antiporter gene (CmNHX1)[22], CmLOX08 promoter[23], CmRAV1 gene [24], CmCAD gene[25], CmNAC gene [26]. There is no research on the role of MYB gene in salt stress of melon.

Here, we cloned a CmMYB1 gene. CmMYB1 gene overexpression did not change the phenotype of transgenic Arabidopsis. However, the expression of CmMYB1 gene increased significantly in the first and third hours of 200 mM NaCl treatment, and the expression of CmMYB1 gene was induced by salt stress, indicating that it played a crucial role in the salt tolerance mechanism of melon.

2.1. Transcriptome analyses

We obtained 28 days fruits of ‘M15’ and ‘Baogua’ after pollination (Fig. 1), and compared their gene expression levels using strand-specifific mRNA sequencing. The results showed that there were a total of 6817 differently expressed genes. Compared to ‘M15’, there were 4370 genes up-regulated and 2377 genes down-regulated in ‘Baogua’ (Fig. 2). We found that the expression levels of 12 MYB transcription factors were significantly different between the two varieties, including MELO3C013071.2, MELO3C012039.2, MELO3C012926.2, MELO3C009678.2, MELO3C010833.2, MELO3C015228.2, MELO3C035029.2, MELO3C017134.2, MELO3C021555.2, MELO3C028590.2, MELO3C020701.2, MELO3C006728.2.

The transcriptome sequencing results of ‘M15’ and ‘Baogua’ were analyzed for significant enrichment in the GO (gene ontology) database, including biological process, molecular function, and cellular component.The results show (Fig. 3) that the differently expressed genes of the two involve multiple metabolic pathways. The proportion of differently expressed genes involved in cell components is highest in the cell periphery, followed by the membrane, component of membrane, extracellular region, external encapsulating stracture, and cell wall also accounts for a higher proportion. Oxidoreductase activity accounts for the highest proportion in molecular functional classification, followed by catalytic activity and protein kinase activity. Differently expressed genes involved in biological processes are mainly concentrated in oxidation-reduction process, followed by response to stimulus, and also involved in aminoglycan catabolic process, and chitin metabolism Chitin metabolic process, chitin catabolic process, cell wall macromolecule catabolic process, amino sugar catabolic process, compound containing glucosamine Glucosamine-containing compound metabolic process, glucosamine-containing compound catabolic process, protein phosphorylation, and so on.

KEGG pathway enrichment analysis showed that differentially expressed genes are mainly involved in starch and sucrose metabolism, MAPK signaling pathway-Plant, amino sugar and nucleotide sugar metabolism (Amino sugar and nucleotide sugar metabolism) and phenylpropanoid biosynthesis(Fig. 4).

2.2. CmMYB1 protein subcellular localization analysis

Throughlaser confocal scanning microscopy, it was observed that CmMYB1 protein is distributed in the cytoplasm and nucleus . However, the green fluorescent signal of CmMYB1-GFP was mainly concentrated on the plasma membrane(Fig. 5). These results indicate that the CmMYB1 protein may be a transcription factor that plays a role in the nucleus and cytoplasm.

2.3. Phylogenetic analysis of CmMYB1

Phylogenetic relationships between CmMYB1 and MYB genes in other plants were explored by constructing an evolutionary tree of amino acid sequence using MEGA 5.1 software. The relationship between CmMYB1 and a gene from the Cucumis sativus (XP004147900.1) was the closest, with 98.19% homology. However, homology with Morella rubra was only 57.68%(Fig.6). This suggests that the MYB gene may have evolutionary differences.

2.4. Phenotypic observation of transgenic A. thaliana lines

The phenotypes of wild-type and transgenic A. thaliana showed no significant difference between the vegetative and reproductive growth phases (Fig. 7).

2.5. RT-PCR to detect the expression of CmMYB1 under salt stress

RT-PCR results showed that, compared with the control, 200 mM NaCl solution treated melon seedlings at 1 h and 3 h showed a significant increase in CmMYB1 expression and began to decline after 6 h. After 24 h, CmMYB1 expression was increased (Fig. 8), indicating that it functions in the early response to salt stress.

Soil salinization is one of the important abiotic stress factors affecting agricultural production and ecological environment. Salt stress destroys ion imbalance and osmotic balance in plants, causing oxidative damage, inhibiting growth and metabolism, and even causing plant death [27,28].

Transcription regulation is a key step for plants to respond to stress, and transcription factors play an important role in the response of plants to stress. Members of the transcription factor family such as AP2/EREBP, MYB, WRKY, NAC, and bZIP/HD-ZIP have been identified to participate in plant response to salt stress. Different transcription factors respond differently under salt stress, indicating that they play different roles in the salt stress response pathway [29-31].

A large number of MYB TFs in plants respond under salt stress. In common wheat, 42 MYB genes respond to salt stress, and most of the MYB genes are transiently up-regulated and down-regulated[30].Under 150 mM NaCl stress, the induced levels of MYB15 in the roots of Arabidopsis thaliana at three detection time points (6 h, 24 h, and 48 h) increased by an average of about 16 times [2].Arabidopsis AtMYBL2 was significantly induced under 300 mM NaCl treatment [6].MYB119, MYB634 and MYB636 were highly induced in the roots of Medicago truncatula; MYB119 reached a maximum at the transcription level after 30 minutes of stress, and began to decline after 6 hours of stress[31]. It shows that it functions in the early response to salt stress.OsMYB91 and OsMYB2 genes were overexpressed in rice, and the results showed that MYB transcription factors have a positive regulation effect on salt stress [32,33].In our experiment, after treatment with 200mM NaCl solution for 1h and 3h, the CmMYB1 gene expression increased significantly, and began to decline after 6h of stress, indicating that it functions in the early response to salt stress.

4.1. Experimental materials

‘M15’ and ‘Baogua’ were planted in 28 days fruit. ‘M15’(male and female) cDNA, ‘M15’ seedlings, wild-type A. thaliana Col-0.

4.2. Transcriptome analysis of ‘M15’ and ‘Baogua’

Total RNA was extracted from fruit using Trizol method (3 biological replicates per sample). RNA integrity was evaluated on 1% agarose gels stained with ethidium bromide (EB). RNA concentration and purity were measured using an Agilent 2100 Bioanalyzer. Total RNA was enriched using Oligo (dT)-attached magnetic beads. First-strand cDNA was synthesized using random hexamer primers and M-MuLV reverse transcriptase. Second-strand cDNA synthesis was subsequently performed using DNA polymerase I and RNase H. After the cDNA library was constructed, PCR amplification was used to enrich the library fragments. The quality of the cDNA library was checked by Agilent 2100 Bioanalyzer, and then the total concentration and the effective concentration of the cDNA library were tested.Mix cDNA libraries with different Index sequences in proportion. Next-Generation Sequencing (NGS) was used to perform paired-end (PE) sequencing of these libraries based on the Illumina sequencing platform.

Raw Data uses Cutadapt to remove sequences with adapters at the 3 'end and removes reads with an average mass fraction below Q20. Use the upgraded version of TopHat2－HISAT2 (http://ccb.jhu.edu/software/hisat2/index.shtml) software to match the filtered Reads to the reference genome (CM3.6.1_pseudomol.fa). DESeq was used for differential analysis of gene expression, and the conditions for screening differentially expressed genes were: the expression multiple | log2 Fold Change |> 1 and the significance P-value <0.05.

4.3. Gene Enrichment and Pathway Analysis

Top GO was used to perform Gene Ontology(GO)enrichment analysis, and differentially expressed genes were analyzed for metabolic pathways of Kyoto Encyclopedia of Genes and Genomes (KEGG).

4.4. Instantaneous transformation of Nicotiana tabacum L.

Instantaneous transformation of Nicotiana tabacum L. refers to the method of Zhang et al.[34].After 72 h, the tobacco leaves were scanned with a laser confocal scanning microscope (Olympus FV1000).

4.5. A. thaliana transformation and Transgenic A. thaliana phenotype observation

Arabidopsis thaliana transformation refers to the method of Zhang et al. [34].Observe the phenotypic differences of transgenic and wild-type A. thaliana during the vegetative and reproductive growth periods

4.6. Melon seedling salt treatment

Melon seeds were germinated via hydroponics to the three-leaf stage and treated with 200 mM sodium chloride for 0-24 h. The culture medium was used as a control.

4.7. RNA extraction and reverse transcription cDNA

RNA was extracted from 200 mM NaCl treated and control melon seedlings using a CWBIO company RNA extraction kit (CW2598S). cDNA was obtained by reverse transcription using total RNA as a template. Reverse transcription reactions were performed with a TaKaRa company PrimeScriptTM RT Reagent Kit.

4.8. RT-PCR

For RT-PCR, a TaKaRa company SYBR® Premix Ex Taq Kit was used. PCR amplification system refers to the method of Wang et al.[35]. RT-PCR amplification primer sequences were:

CmMYB F1:TCCATGGATGGAAAGGACACT, CmMYB R1:TCAACATCTGGTTTTGACACTTGAA; Actin MELO3C023264 F: TGCCCAGAAGTTCTATTCCAGC, Actin MELO3C023264 R: CATAGTTGAACCACCACTGAGGAC.

We compared the transcriptomes of ‘M15’ and ‘Baogua’. Transcriptome analysis found that the expression levels of 12 MYB transcription factors were significantly different between the two varieties. We cloned the melon CmMYB1 gene, and subcellular localization revealed that the CmMYB1 protein is distributed in the cytoplasm and nucleus. The transgenic CmMYB1A. thaliana was not significantly different from wild type. With 200 mM NaCl solution treatment on melon seedlings, the expression of CmMYB1 increased significantly at 1 h and 3 h. This shows that CmMYB1 plays a role in the salt resistance of melon.

Author Contributions:Z.H.J. and Y.Z. conceptualized the project. Formal analysis of results were conducted by Y.S.Y., Z.Y.D. and S.Q.W. Funding for the project was acquired by H.J.Z. Methodology was designed by H.J.Z. ,Y.Z. and Y.S.Y., and all experiments were supervised by Z.Y.D. and S.Q.W. Y.Z. wrote the original draft of the manuscript, and H.J.Z., Y.S.Y. reviewed and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding: This work was supported by the National Natural Science Foundation of China (31640069), Natural Science Foundation of the Educational Commission of Anhui Province (KJ2016B015, KJ2017B021), Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Northeast Region), Ministry of Agriculture /Northeast Agricultural University (201603), Anhui Provincial University Super Talents Funding Program (gxgwfx2018033).

Conflicts of Interest: The authors declare no conflict of interest.

Dubos, C. et al. MYB transcription factors in Arabidopsis. Trends Plant Sci.15, 573-581, https://doi.org/10.1016/j.tplants.2010.06.005(2010).
Stracke, R., Werber, M., Weisshaar, B. The R2R3-MYB gene family in Arabidopsis thaliana. Opin. Plant Biol. 5 , 447-456(2001).
Wilkins, O., Nahal, H., Foong, J., Provart, N.J.,Campbell, M.M. Expansion and diversification of the Populus R2R3-MYB family of transcription factors. Plant Physiol. 149, 981-993(2009).
Matus, J.T., Aquea, F., Arce-Johnson, P. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes. BMC Plant Biol. 8:83-97(2008).
Du, H., Feng, B., Yang, S.,Huang,Y.,Tang,Y. The R2R3-MYB transcription factor gene family in PLoS One. 7:e37463(2012).
Chen, Y.H. et al. The MYB Transcription factor superfamily of Arabidopsis:expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol. Biol. 1, 107-124(2006).
Zhao, L.,Gao, L.,Wang, H.The R2R3-MYB, bHLH, WD40 and related transcription factors in flavonoid biosynthesis. Funct Integr. Genomics. 1, 75-98(2013).
Stracke, R. et al. Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. Plant J. 50, 660-677, https://doi.org/10.1111/j.1365-313X.2007.03078.x (2007).
Zhong, C.M. et al. The R2R3-MYB transcription factor GhMYB1a regulates flavonol and anthocyanin accumulation in Gerbera hybrida. Res. 1, 884-915,https://doi.org/10.1038/s41438-020-0296-2(2020).
Feng, C., Ding, D.H., Feng, C., Kang, M. The identification of an R2R3-MYB transcription factor involved in regulating anthocyanin biosynthesis in Primulina swinglei flowers. 752,144788(2020).
Heppel, S.C. et al. Identification of key amino acids for the evolution of promoter target specificity of anthocyanin and proanthocyanidin regulating MYB factors.Plant Mol.Biol.82,457-471, https://doi.org/1007/s11103-013-0074-8 (2013).

Wen, B.B. et al. The R2R3-MYB transcription factor CsMYB73 negatively regulates l -Theanine biosynthesis in tea plants ( Camellia sinensis L.). Plant Science. 298, https://doi.org/1016/j.plantsci.2020.110546(2020).
Zhong, R.Q., Lee, C.H., Zhou, J.L.McCarthy, R.L., Ye, Z.H. A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell. 20, 2763-2782(2008).
Zhou, J., Lee, C., Zhong, R., Ye, Z.H. MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis. Plant Cell. 21, 248-266(2009).
Cominelli, E., Galbiati, M., Vavasseur, A.A guard-cellspecific MYB transcription factor regulates stomatal movements and plant drought tolerance. Biol.13, 1196-1200(2005).
Chen, B. et al. Identification,cloning and characterization of R2R3-MYB gene family in canola(Brassica napus L.)identify a novel member modulating ROS accumulation and hypersensitive-like cell death. DNA Res. 2, 101-114, https://doi.org/10.1093/dnares/dsv040(2016).

Shin, R. et al. The Arabidopsis transcription factor MYB77 modulates auxin signal transduction. The Plant Cell 2007, 8, 2440-2453,https://doi.org/10.1105/tpc. 107.050963 (2007).

Wang, S.Isolation and characterization of a vacuolar Na+/H+antiporter gene from Cucumis melo.African J. Biotechnol. 10, 1752-1759(2011).
Wang, C.H., Gao, G., Cao, S.X., Xie, Q.J., Qi, H.Y. Isolation and functional validation of the CmLOX08 promoter associated with signalling molecule and abiotic stress responses in oriental melon, Cucumis melo var. makuwa Makino. BMC Plant Biol.19, 75(2019).
Zhao, L.N. et al.CmRAV1 shows differential expression in two melon (Cucumis melo L.) cultivars and enhances salt tolerance in transgenic Arabidopsis plants. ACTA Biochimica ET Biophysica Sinica. 11, https://doi.org/1123-1133, 10.1093/abbs/gmz107(2019).

Liu, W. et al.Analysis of CmCADs and three lignifying enzymes in oriental melon ('CaiHong7') seedlings in response to three abiotic stresses.Scientia Hortic. 237, 257-268, https://doi.org/10.1016/j.scienta.2018.04.024(2018).
Wei, S.W.et al.Genome-wide investigation of the NAC transcription factor family in melon (Cucumis melo L.) and their expression analysis under salt stress.Plant Cell Reports. 9, 1827-1839, https://doi.org/10.1007/s00299-016-1997-8(2016).
Glenn, E.P.; Brown, J.J.; Blumwald, E.Salt tolerance and crop potential of halophytes.CritRev Plantsci. 2, 227-255(1999).
Niu, X., Bressan, R.A.,Hasegawa, P.M., Pardo, J. M.Ion homeostasis in NaCl stress environments. Plant Physiol. 3, 735-742(1995).
Jiang, Y., Deyholos, M.K. Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes. BMC Plant Biol. 6, 25(2006).
Kawaura, K., Mochida, K., Ogihara, Y. Genome-wide analysis for identification of salt-responsive genes in common wheat. Funct.&Integr. Genom. 3, 277-286(2008).
Gruber, V.; Blanchet, S.; Diet, A.Identification of transcription factors involved in root apex responses to salt stress inMedicago truncatula. Genet and Genom. 1, 55-66(2009).
Zhu, N. et al.The R2R3-type MYB gene OsMYB91 has a function in coordinatingplantgrowth and salt stress tolerance in rice. Plant Science. 236, 146-156,https://doi.org/10.1016/j.plantsci.2015.03.023(2015).
Yang, A., Dai, X.Y., Zhag, W.H. A R2R3-type MYB gene,OsMYB2,is involved in salt,cold,and dehydration tolerance in rice. J. Exp. Botany. 7, 2541-2556(2012).
Zhang, H.J., Zhang, Y. Molecular cloning and functional characterization of CmFT (FLOWERING LOCUS T) from Cucumis melo L. J. genetics. 1, 41 (2020).
Wang, Y.Y. et al. Transcription factor PyHY5 binds to the promoters of PyWD40 and PyMYB10 and regulates its expression in red pear ‘Yunhongli No. 1’. Plant Physiol. Bioch. 2020, 154, 665-674, https://doi.org/10.1016/j.pl2020. 07.008(2020).

Download PDF

Version 1

posted

You are reading this latest preprint version

Transcriptome Analysis, CmMYB1 Gene Clone From Cucumis Melo L. And Its Functional Roles Under Salt Stress

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

3. Discussion

4. Materials And Methods

5. Conclusions

Declarations

References

Status:

Version 1