2.1 Animals and experimental design
Thirty 6-8-week-old C57BL / 6 mice weighing 18-25 g were purchased from Liaoning Changsheng Biotechnology Co., Ltd. [ SCXK ( Liao ) 2020- 0001 ]. The experimental unit is the SPF animal room [ SYXK ( Ji ) 2018-0014 ] of the Experimental Animal Center of Changchun University of Traditional Chinese Medicine. The feeding conditions are ( 22 ± 2 ) °C, lighting every half of the day and night, free to eat and drink water, and the experiment begins after 7 days of feeding. The experimental procedures were strictly in accordance with the guiding principles of the Animal Ethics Committee of Changchun University of Traditional Chinese Medicine ( number : ccucm-2017-0015 ).In this study, young mice were selected to determine the feasibility of new surgical techniques and investigate the physiological healing process of tibia. Mice are placed in groups of up to five animals and are free to eat and drink standard mice.Anesthesia with intraperitoneal injection of pentobarbital sodium ( 60 mg / Kg ) in mice.Mice were allowed to move freely after operation. Monitor animals daily to study non-physiological or physiological body load and gait patterns.After 7,14,21,28 days, the mice were sacrificed by cervical dislocation.Fractured tibia were harvested and fixed in 4% paraformaldehyde.Afterward, implant material was removed and fractured tibia were subjected to microcomputed tomography (µCT) scans and decalcified histology.
2.2 Tibial anatomy of mice
The lower leg of C57BL / 6 mice is also composed of tibia and fibula. The upper end of the tibia is triangular in the middle and lower 1 / 3 level, and it is round-like and fused with the fibula. At the same time, the skin in front of the tibia is thin and there is little muscle attachment, which is very similar to the anatomical characteristics of human tibia(Figure 1). Therefore, it is very reasonable to use the tibia fracture of C57BL / 6 mice as an animal model to simulate the fracture of human tibia.
2.3 Surgical procedure
The mice were intraperitoneally injected with 5 % chloral hydrate at a dose of 10 mg / kg. After deep anesthesia, the right leg of the mice was prepared for skin disinfection. A 0.5 cm incision was made in front of the right leg, and the tibia was completely exposed. During the process, attention was paid to the protection of important nerve, blood vessels and muscles. The microstructure was sheared horizontally at the middle and lower 1 / 3 level of the tibia. The 0.37 mm stainless steel metal needle was inserted into the proximal medullary cavity of the fracture end, and it was punctured in front of the proximal tibia. Then the metal needle was reversely inserted into the distal medullary cavity of the fracture. The metal needle was retained in the medullary cavity to fix the fracture end, showing good alignment and alignment of the fracture end and good stability(Figure 2). After recovery, the mice were reared in cages, and 80 U penicillin was injected intraperitoneally for 3 consecutive days. The mice were free to move, eat and drink.
2.4 X-ray filming
The mice were fixed in supine position, so that their bilateral lower limbs were extended outward, and the tibia and fracture ends of the mice were exposed in position as far as possible, and placed in the center of the field of vision. X-ray images were used to confirm that the metal fixative was retained in the tibial bone marrow cavity and the fracture ends were fixed, so as to prove the success of the mouse fracture model construction. At the same time, the X-ray situation was checked according to the schedule, so as to check the fracture healing.
2.5 Micro-CT analysis
Mice were euthanized at days 14, 21,28 for further tests. X-ray radiographic detection were performed firstly to detect the situation of fracture healing. After scrupulous dissection and removal of the in[1]tramedullary pins in fractured tibiae, Micro-CT was used to scan the fracture specimens at the different time points. Callus total volume (TV) ,callus bone volume (BV),bone surface(BS),Tb.Th and Tb.Sp were collected for quantitative analysis of bony callus.
2.6 Histological analysis
After fracture bone tissues were harvested at days14,21,28, 4 %paraformaldehyde was used to fix for 2 days. After that, samples were soaked in 14 % EDTA solution for decalcification for fortnight and were embedded in paraffin subsequently. 3-μm thick sections at the fracture site were cut sagittally for Saffron O fixation green staining. Afterwards, histomorphometric analysis (n =3) was performed.
2.7 Immunohistochemical stainings
After fracture bone tissues were harvested at days14,28, 4 %paraformaldehyde was used to fix for 2 days. After that, samples were soaked in 14 % EDTA solution for decalcification for fortnight and were embedded in paraffin subsequently.Paraffin-embedded 7-µm longitudinal sections were prepared for immunohistochemical staining, the following antibodies were used: rabbit anti‐mouse collagen Ⅰ(14695-1-AP, dilution 1:200), rabbit anti‐mouse collagen Ⅱ(28459-1-AP, dilution 1:200) and horse[1]radish peroxidase-conjugated streptavidin (Zytomed Systems). Quantification of the positively stained regions was performed using the image analysis software.
2.8 Quantitative real time PCR analysis (qRT-PCR)
The expression levels of identified DEGs were further validated by quantitative real-time PCR (qRT-PCR). Briefly, total RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-Rad, USA) and amplified using SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad, USA) on a CFX Connect Real-Time PCR Detection System (Bio-Rad, USA) under the following amplification conditions: 95°C for 3 min, followed by 39 cycles at 95°C for 10 sec, 60°C for 30 sec and 72°C for 10 sec, and then a final extensional step from 65°C to 95°C with increment of 0.5 °C for 5 sec. Relative gene expression level was normalized to the rat glyceraldehyde 3-phosphate dehydrogenase gene (Gapdh) following the 2-ΔΔCT method . The sequence of primers is shown in Table 1.
Table 1
Primer sequence
Gene name
|
|
5' - 3'
|
Gapdh
|
Forward primer
|
CCTGCACCACCAACTGCTTA
|
|
Reverse primer
|
GGCCATCCACAGTCTTCTGAG
|
Runx2
|
Forward primer
|
CTGGCCTTCCACTCTCAGTAA
|
|
Reverse primer
|
ACTGGCGGGGTGTAAGTAAAG
|
Col1a1
|
Forward primer
|
GTGGCGGTTATGACTTCAGC
|
|
Reverse primer
|
TCACGAACCACGTTAGCATC
|
Col2a1
|
Forward primer
|
ACATAGGGCCTGTCTGCTTCTTGT
|
|
Reverse primer
|
TGACTGCGGTTGGAAAGTGTTTGG
|
Sox9
|
Forward primer
|
TCCACGAAGGGTCTCTTCTC
|
|
Reverse primer
|
AGGAAGCTGGCAGACCAGTA
|
2.9 Statistical analysis
Most data sets were normally distributed. Therefore,results are presented as dot plots with mean ± standard deviation.Statistical analysis was done by Student's t test (GraphPad Prism ).The level of significance was set at P < 0.05. The group size was three.