Patients and tissue microarrays
The protocol to generate the tissue microarrays (TMAs) in this cohort has been described in our previous report(9). We retrospectively reviewed our patients with advanced disease on adjuvant hormonal therapy after prostatectomy. A total of 79 patients in our single center were included in this study. Those who has lost follow-up or benign tissue on the TMA were excluded. All these patients were performed laparoscopic radical prostatectomy followed by adjuvant hormonal therapy between 2012 and 2014 at the urology department of the First Affiliated Hospital of Nanjing Medical University. All patients were recruited following informed consent, the protocol was approved by ethical committee of The First Affiliated Hospital of Nanjing Medical University. Progression to castration resistant prostate cancer (CRPC) defined as biochemical recurrence or metastasis on adjuvant hormonal therapy. For the staining score system, we have described the protocol in our previous report(9). Briefly, For the staining score system (11), the percentage of positive tumor cells was determined by at least five areas at 400 magnification and assigned to one of the following five categories: 0 <5%; 1:5-25%; 2: 25-50%; 3: 50-75%, and 4: >75%. The intensity of immunostaining was scored as follows: 1 low, 2, moderate, and 3, strong. The IHC score for ALDH1A3 on prostate cancer slides was: low expression <8, and high expression ≥8.
Database and bioinformatics
Three datasets (Cornell(12), MSKCC(13), Michigan group(10)) on prostate cancer samples sequencing profiles were found and the RNA sequencing data in RPKM format were downloaded. The ALDH1A3 expression value for each samples in mCRPC group and primary cancer group were compared in each dataset. The results were shown by GraphPad software.
Gene Set Enrichment Analysis (GSEA) analysis
The RNA sequencing data were downloaded from SU2C database. The median value of RPKM for ALDH1A3 was used as cut-off value, any sample which is higher than the median value was determined as ALDH1A3high, the lower samples as ALDH1A3low. The GSEA analysis was performed according to the protocol which was previously described(14). The Genesets were downloaded from the Molecular Signatures Database (MSigDB http://software.broadinstitute.org/gsea/msigdb/)
Cell culture and Crispr-Cas9 knockout
The human prostate cancer cell line (LnCaP, VCaP) were purchased from the Cell Bank Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and maintained in RPMI medium with 10% fetal bovine serum within a humidified atmosphere containing 5% CO2 at 37°C.
We designed the guide RNA for ALDH1A3 from (http://crispr.mit.edu/), targeting the first exon. The sequence of the guide is as follows—ALDH1A3: 1- AGTTATGGCTACCACCAACG; 2-TAGTCTGCGGCGCACCGGCT; green fluorescent protein (GFP): GGCGAGGAGCTGTTCACCG. Then, we ligated the guide to the LentiCrispr-V2 system followed by Sanger sequencing validation(15). Finally, we produced the lentivirus according to the protocol previously described(9). After 2 days of the infection to the LnCaP and VCaP cells, the puromycin selection was performed. We performed Western Blot assay to validate the knockout efficiency after 14 days of infection. The cell numbers were counted based on the typan blue staining.
Western Blotting
The protein expression of ALDH1A3 by Western Blot assay was performed according to the protocol previously described. The antibodies against ALDH1A3 (Abcam, USA), Phospho-Akt (Ser473, Cell Signaling Technology, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Bioworld Technology, Inc., USA) were used in Western Blot assay in accordance with the manufacturer’s instructions.
Statistical analysis
Differences in vitro experiment like cell numbers between groups were subjected to Student’s t test. p<0.05 was considered to be statistically significant. All the statistical calculations were performed using GraphPad Prism v6.0 software (GraphPad Prism version 6.00 for Windows, GraphPad Software, La Jolla California USA, www.graphpad.com).